... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...

Еще в разделе: (Показать все результаты (>3) - polit.msu.ru/ )

Cell. ... 2012) 69:1787­1797 DOI 10.1007/s00018-011-0895-z Cellular and Molecular Life Sciences REVIEW Cytochrome c: the Achilles' heel in apoptosis A. V. Kulikov · E. S. Shilov · I. A. Mufazalov · V. Gogvadze · S. A. Nedospasov · B. Zhivotovsky Received: 5 September 2011 / Revised: 30 October 2011 / Accepted: 22 November 2011 / Published online: 17 December 2011 с Springer Basel AG 2012 Abstract Cytochrome c is a well-known ... How is cytochrome c released from mitochondria? ...

Еще в разделе: (Показать все результаты (>6) - www.fbm.msu.ru/ )

• http://www.fbm.msu.ru/about/struct/labs/lima/paper1.pdf

Introduction to PLASMA ASTROPHYSICS (Selected 10 lectures) Boris V. Somov Astronomical Institute and Faculty of Physics Moscow State University Pushino-na-Oke, 2008 Contents Ab out These Lectures 1 Particles and Fields: Exact Self-Consistent Description 1.1 Liouville's theorem . . . . . . . . . . . . . . . . . . . 1.1.1 Continuity in phase space . . . . . . . . . 1.1.2 The character of particle interactions 1.1.3 The Lorentz force, gravity . . . . . . . . . 1.1.4 Collisional friction . . . . . . . . . . . .

Еще в разделе: (Показать все результаты (>3) - sun.sai.msu.ru/ )

Langmuir 2005, 21, 8243-8249 8243 The "Wimple": Rippled Deformation of a Fluid Drop Caused by Hydrodynamic and Surface Forces during Thin Film Drainage Lucy Y. Clasohm,, Jason N. Connor,,| ... In Final Form: June 16, 2005 It is well-known that hydrodynamic pressures in a thin draining liquid film can cause inversion of the curvature of a drop or bubble surface as it approaches another surface, creating a so-called "dimple". ... WimplesRippled Deformation of a Fluid Drop Langmuir, Vol. ...

Еще в разделе: (Показать все результаты (>32) - nanofluidics.phys.msu.ru/ )

• http://nanofluidics.phys.msu.ru/paper/Mendeleev-2012.pdf
• http://nanofluidics.phys.msu.ru/paper/Dubov_2012.pdf
• http://nanofluidics.phys.msu.ru/paper/jpcm2011.pdf

... 2007. 2008. ... 2010. ... JASSS), Cliodynamics ArXiv: http:// arxiv.org/list/physics.soc-ph/recent () 1. ... 170, 419 (2000) (~19 . ... Simulating Social and Economic Specialization in Small-Scale Agricultural Societies, JASSS, 2013, 16 (4), 4 Suarez J.L., Sancho F., JASSS, 2011, 14 (4), 19, http://projects.culturplex.ca A.Ghorbani, et al., MAIA: a Framework for Developing Agent-Based Social Simulations, JASSS, 2013, 16 (2). http://jasss.soc.surrey.ac.uk/16/2/9.html J.B. Fletcher, et al. ...

Еще в разделе: (Показать все результаты (>5) - www.soc-phys.chem.msu.ru/ )

... История медицинского образования в МГУ . ... ;legends of cardiology and leading cardiologists on general cardiology and additional knowledge of interventional cardiology, cardiovascular imaging (echocardiography, cardiac CT, CMR, nuclear and PET scan), cardiovascular intensive care, electrophysiology and device therapy, advanced heart failure and transplantation, cardiac rehabilitation and prevention, grown-up congenital heart disease (GUCH), genetic and regenerative cell treatment of...

Еще в разделе: (Показать все результаты (>4) - fbm.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

... Научные семинары . ... расписание семинаров . семинар 1 . ... Отчет о семинаре || ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...

Еще в разделе: (Показать все результаты (>12) - nano.msu.ru/ )

• MSU Nanotechnology Education and Research Center. Mission. | MSU Nanotechnology
• Seminar Information. Prospective Nanomaterials | MSU Nanotechnology Education
• Announcement about the admission to MSU Graduate School for a new Master?s

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>4) - asa.guru.ru/ )

• Alexander Antonov's Resume

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>16) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/Template.doc
• http://hit-conf.imec.msu.ru/2006/CD/RibushkinaG.pdf
• Moscow 2006

... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...

272. www.99ru.ru - RAWLS, John (1921 - 2002) 2507

273. News. 14 European Symposium on Gas Phase Electron Diffraction