THE PROBLEM OF COUNABILITY OF HIGHEST ORDINALS . ... The first form corresponds to the geometric representation of ordinal w n as an infinite n -dimensional matrix. According traditional formulation w w = U w i , i =1, w , thus w w is w -countable union of countable ordinals so w w is countable. ... TWO METHODS OF RENUMBERING OF ELEMENTS OF ORDINALS The fist infinite ordinal w designates the set of natural numbers which is countable by definition. ... This matrix represents ordinal w (w ^ w) . ...
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
... Faculty of Physics . ... Divisions Chairs . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
of Fluid Mechanics: Email alerts: Click here Subscriptions: Click here Commercial reprints: Click here Terms of use : Click here Effective slip boundary conditions for arbitrary one dimensional surfaces Evgeny S. Asmolov and Olga I. Vinogradova Journal of Fluid Mechanics / Volume 706 / September 2012, pp 108 117 DOI: 10.1017/jfm.2012.228, Published online: Link to this article ... S M O L OV Effective slip boundary conditions for arbitrary one-dimensional surfaces S TO N E 117 , H . ...
[
Текст
]
Ссылки http://nanofluidics.phys.msu.ru/paper/asmolov-vinogradova-2012.pdf -- 660.7 Кб -- 31.08.2012 Похожие документы
February 11, 1997 Neurokinetics Case Study Background 2 The Bionic Glove 2 Details 2 Development 3 Commercialization 4 The Issues 4 Intellectual Property 4 The Market 5 Distribution 7 Clinical Trials 7 Product Development 9 Regulatory Considerations 10 Sales Projections 11 Financing 12 Commercial ... Research indicated that the target market for Canada and the United States combined was approximately 76,850 existing patients with 2,850 new patients anticipated each year. ... patients | ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/neurokineticscasestudy.doc -- 189.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/neurokineticscasestudy.doc -- 189.0 Кб -- 27.10.2005 Похожие документы
О лаборатории . Публикации . ... Лаборатория теоретической биофизики . ... Биофизика, 57(2) 197?204 (2012) . ... П. М. Красильников , П. П. Нокс, А. Б. Рубин. О влиянии локального молекулярного окружения на величину редокс-потенциала кофакторов электронного переноса в бактериальных фотосинтетических реакционных центрах, Биофизика 56(2) 248-254 (2011) . ... Биофизика 56(2) 255-264 (2011) . ... А.М. Нестеренко , П.М. Красильников , Ю.А. Ермаков. ... 2008 ERG Research Group . ...
ЭКОЛОГИЧЕСКОЕ ПРОГНОЗИРОВАНИЕ И СОВЕРШЕНСТВОВАНИЕ АГРОТЕХНОЛОГИЙ . ... В статье рассмотрены вопросы прогнозирования динамики региональных гео- и агроэкологических систем и информационного обеспечения экологических моделей. ... Это связано с тем, что отсутствуют общепринятые методы представления сведений в автоматизированных информационных системах, обеспечивающие обработку метеорологических данных и создание агроэкологических моделей продуктивности и плодородия почв в системе (рис. ...
Uneex . SeminarTraffic . ... Анализ трафика -- зачем это нужно. ... Источники информации о трафике. ... Cisco accounting и NetFlow ( вот тут информации недостаточно, если кто-то может рассказать про эту часть -- хорошо ). ... В формате SXI (ooImpress) . ... Обзор биллинговых систем и систем учета трафика: http://www.opennet.ru/prog/sml/47.shtml . ... Интересная разработка: система адаптивного агрегирования информации о трафике. http://camelot.iki.rssi.ru/RFFI-02-07-90390 . ... Action: . ...
ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...
... Начало www.99ru.ru Образование и наука Физика 1672 . ... Искусство . История.Философия . ... Художественные . ... История Всемирная . ... Искусство и культура . ... Другие виды искусства . ... Теория искусств.Эстетика . ... Этнография Фольклор . ... Военное дело Военная история . ... Наследие Востока . ... Введите код товара из каталога. автор Теория относительности . Дирак П. Общая теория относительности. ... Теория относительности . ... Общая теория относительности в физической картине мира. ...
... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...
... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...
... Conference organizers: . Institute for the Study of Terrorism University of Information Technology and Management in Rzeszow . ... The University of Information Technology and Management welcomes academic experts and practitioners from different countries who are interested in presentation of their research findings on the theme Systems and institutions to combat terrorism in Poland and abroad for the 2016 conference. ... State and civil institutions in combating terrorism; . ... Prof., PhD . ...
Published on Совет молодых ученых ВМК МГУ ( http://smu.cmc.msu.ru ) . Главная > Мероприятия > Конференция ?Ломоносов? > 2013 . ... XX Международная конференция Ломоносов-2013 проходит с 9 по 12 апреля 2013 года. Официальный сайт конференции Ломоносов -љ http://lomonosov-msu.ru [1] . ... Руководители: Шевцова Ирина Геннадьевна, Нефедова Юлия Сергеевна . ... Ответственный секретарь љ? ассистент к.ф.-м.н. Шевцова Ирина Геннадьевна . ... Программа секции ВМК 9-11 апреля 2013г. [3] . ...
Published on Совет молодых ученых ВМК МГУ ( http://smu.cs.msu.ru ) . Главная > Мероприятия > Конференция ?Ломоносов? > 2013 . ... XX Международная конференция Ломоносов-2013 проходит с 9 по 12 апреля 2013 года. Официальный сайт конференции Ломоносов -љ http://lomonosov-msu.ru [1] . ... Руководители: Шевцова Ирина Геннадьевна, Нефедова Юлия Сергеевна . ... Ответственный секретарь љ? ассистент к.ф.-м.н. Шевцова Ирина Геннадьевна . ... Программа секции ВМК 9-11 апреля 2013г. [3] . ...
Published on Совет молодых ученых ВМК МГУ ( http://smu.cs.msu.su ) . Главная > Мероприятия > Конференция ?Ломоносов? > 2013 . ... XX Международная конференция Ломоносов-2013 проходит с 9 по 12 апреля 2013 года. Официальный сайт конференции Ломоносов -љ http://lomonosov-msu.ru [1] . ... Руководители: Шевцова Ирина Геннадьевна, Нефедова Юлия Сергеевна . ... Ответственный секретарь љ? ассистент к.ф.-м.н. Шевцова Ирина Геннадьевна . ... Программа секции ВМК 9-11 апреля 2013г. [3] . ...
... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы