Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>12) - mph.cmc.msu.ru/ )

... Anti thrombin DNA aptamers were immobilized on silica microspheres, placed inside microwells on the distal tip on an imaging optical fiber, coupled to a modified epifluorescence microscope through its proximal tip. ... It should be mentioned that since thrombin is not a DNA binding protein, the possibility to elicit thrombin­aptamer complexes clearly demonstrates the power of SELEX technology. ... Specificity of aptamer coated beads for F thrombin binding was assessed with bovine serum albumin. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf
• http://rnp-group.genebee.msu.su/pdfs/febsz.pdf
• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf

... О факультете . ... The Second White Sea Molecular Zoology Summer School . ... N.A.Pertzov White Sea Biological Station (WSBS MSU) invites undergraduate and graduate students studying zoology and ecology to participate in summer field school on Molecular Zoology, which will take place in September 5-19, 2010. ... Overview of major groups of invertebrates inhabiting the White Sea, determination of species with taxonomic keys, primer on zoological drawings. ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>6) - www.bio.msu.ru/ )

проекты . ... летняя школа . онлайн проекты . ... школа ?1254 . ... e-mail: info@sch1254.ru, support@sch1254.ru . ... наших курсов . ... курсы . Microsoft . ... Oracle . ... IBM . Подготовительные курсы МГУ || помощь студентам || олимпиады || проекты . ... курсы Microsoft || курсы Oracle || курсы IBM || . e-mail: umsh@fizmatclass.ru || тел.: ... НОУ "УНИВЕРСИТЕТСКАЯ МАТЕМАТИЧЕСКАЯ ШКОЛА", 1995-2016 . ...

Еще в разделе: (Показать все результаты (>2) - www.fizmatclass.ru/ )

... Biological Faculty . Moscow State Lomonosov University . ... EDUCATION : B.S. Lomonosov Moscow State University, 1971 Physics . M.S. Lomonosov Moscow State University, 1972 Biophysics . Ph.D. Lomonosov Moscow State University, 1978 Biophysics . ... Lomonosov Moscow State University, 1990 Biophysics . ... 1972-1978 Research assistant Lomonosov State University, Moscow . ... Mathematical modelling in biology, . ... Lecturer at Biological Faculty, Lomonosov State University, Moscow . ...

Еще в разделе: (Показать все результаты (>5) - biophys.msu.ru/ )

• Stress of plant cells

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• ConClus
• Nhunt: program for nucleic acid sequence similarity search

BIRD SPECIES DATABASE . of the Arctic Birds Breeding Conditions Survey . ... Queries . View list of species . ... Get list of species, for which data are available by pushing "Query" button below "View list of species" invitation. Latin name of a species can be copied from the list to the "Species name" field or typed-in there (but exactly as it appears in the species list). ... Query results will be tabulated in the window below the map, and can be browsed through or copied. ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>7) - belyakov.imec.msu.ru/ )

Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...

270. http://temporology.bio.msu.ru/EREPORTS/korotaev_experimental.pdf

271. Учебный год 2015/2016 | Курс АиАЯ

272. Русско-германский институт.

273. http://library.biophys.msu.ru/PDF/3336.pdf

274. Факультет иностранных языков МГУ. Центр Дистанционного обучения.

275. http://acoustics.phys.msu.su/teachers/lecture/matmodel.pdf

276. Марчук Юрий Николаевич, профессор, доктор филологических наук

277. http://www.law.msu.ru/doc/maleshin-rus-civil-proc.pdf

278. http://hit-conf.imec.msu.ru/books/NeZaTeGiUs_2010.pdf

279. http://cosrad.sinp.msu.ru/experiments/tus/doc/global2007.pdf

280. http://antares.sinp.msu.ru/docs/NIMA.pdf