... Publications . ... Cosmic rays of extremely high energy . ... M.I. Panasyuk. ... B.A. Khrenov. ... M.I. Panasyuk and B.A. Khrenov. Envoys of space: far or near? Ultrahigh energy cosmic rays. ... Cosmic rays of the highest energy ? ... Space Program KOSMOTEPETL (Projects KLYPVE and TUS ) for the Study of Extremely High Energy Cosmic Rays. ... KLYPVE/TUS space experiment for study of the ultrahigh energy cosmic rays.љ ... Space Detector TUS for Extreme Energy Cosmic Rays Study. ...
... Изображения. ... IMAGE: READ/IMAGE, WRITE/IMAGE, COMPUTE/IMAGE, COPY/II .. ... версии 98NOV с кратким описанием того, что данная команда выполняет. asload назначение дисплейного окна и визуализация в нем изображения ; areatable построение таблицы, содержащей определение областей заданного разме- ра, равномерно покрывающих заданное изображение; 95 autocuts определение хороших уровней для визуализации изображения ; buildcube построение куба данных из заданного набора двумерных ...
I NSTITUTE OF PHYSICS PUBLISHING PHYSICAL B IOLOGY Phys. Biol. 3 (2006) 121129 doi:10.1088/1478-3975/3/2/004 Direct simulation of plastocyanin and cytochrome f interactions in solution I B Kovalenko1,AMAbaturova1, P A Gromov2,DMUstinin1, E A Grachev2, G Yu Riznichenko1 and ABRubin1 1 2 ... 2006 Online at stacks.iop.org/PhysBio/3/121 Abstract Most biological functions, including photosynthetic activity, are mediated by protein interactions ... We use this structure in our simulation. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...
... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...
Координатор семинара : академик РАН и Academia Europaea Алексей Ремович Хохлов . ... Заседания семинара проводятся в Конференц-зале Института элементоорганических соединений им. А.Н. Несмеянова РАН ( ИНЭОС РАН , г. Москва, ул. Вавилова, 28). ... Скачать объявление о семинаре . ... Б.М. Графов (Интститут физической химии и электрохимии имени А.Н. Фрумкина РАН, Москва) . ... После доклада предполагается обсуждение целесообразности организации Общемосковского семинара по электрохимии. ...
... Data . ... Planetary perturbations during geomagnetic storms are measured by the Dst index, which is the deviation of variation of the magnetic field from the undisturbed level, averaged over the values measured at the control chain of magnetic stations located in the low latitudes. ... To predict the hourly values of the Dst index, artificial neural networks (ANN) of perceptron type are used. ... Loading of the data on the values of the Dst index and forecast update are performed twice per hour. ...
... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...
... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... We present the simulation framework CRPropa version 3 designed for efficient development of astrophysical predictions for ultra-high energy particles. Users can assemble modules of the most relevant propagation effects in galactic and extragalactic space, include their own physics modules with new features, and receive on output primary and secondary cosmic messengers including nuclei, neutrinos and photons. ...
... О кафедре . Кафедра суперкомпьютеров и квантовой информатики . ... Кафедра проводит обучение по образовательной программе шестилетней интегрированной подготовки высококвалифицированных специалистов с последовательным освоением образовательной программы бакалавриата (4 года) по профилю ?Системное программирование и компьютерные науки? и образовательной программы магистратуры (2 года) по двум магистерским программам: ?Суперкомпьютерные системы и приложения? и ?Квантовая информатика?. ... ИПМ РАН . ...
SVETKA, a program for analysis of different alignments . Back to the help page . ... Such a feature can look like " Leucine in the position 362 of the alignment of the entire family " and can, in many cases, be a "decision rule" to distinguish sequences from two sides of a tree branch. ... Comparing the alignment with an input tree (the tree may be entered by the user or reconstructed with the WPGMA algorithm), the program detects supporting positions of the alignment for every branch the tree. ...
Setting Up a Pay System Canada Business Service Centres - CBSCs Last Verified: 2004-05-28 Document No. 4046 Summary Pay administration is a management tool that enables you to control personnel cost, increase employee morale, and reduce work force turnover. ... This publication provides time-tested concepts for determining competitive pay levels and for maintaining fair pay relationships among the jobs comprising a small company. ... appraise employee performance under the plan. ... job title; . ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/settingupapaysystem.doc -- 112.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/settingupapaysystem.doc -- 112.0 Кб -- 27.10.2005 Похожие документы
... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...
e-mail: theory@socio.msu.ru) , , , - , , , , , , , , nation, political nation, Ethnicity, national-cultural autonomy, civil society, Multi-ethnic state, national people, national culture, national policy, national interests and nationalism , , . Proceeding from the assumption that nation is the most stable and sustainable social community, the author analyses the role and significance of the national factor in the contemporary society. ...
[
Текст
]
Ссылки http://www.socio.msu.ru/vestnik/archive/2011/3/07.pdf -- 117.9 Кб -- 06.11.2012
[
Текст
]
Ссылки http://vestnik.socio.msu.ru/archive/2011/3/07.pdf -- 117.9 Кб -- 12.01.2015 Похожие документы
... В левой части открывшегося окна Group Policy найдите раздел Local Computer Policy | ... Windows Update . ... Дважды щелкните по строке Configure Automatic Updates , в открывшемся окне поставьте переключатель в положение Enabled. ... Задав настройки для параметра Configure Automatic Updates, щелкните Next Policy и в окне Specify intranet Microsoft update service location Properties поставьте переключатель в положение Enabled, а в обоих полях ввода текста обязательно введите http://wsus.chem.msu.ru . ...