... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...
... Aerospace and environmental medicine Automation and Remote Control Optoelectronics, Instrumentation and Data Processing Acoustical Physics St Petersburg Mathematical Journal Algebra and Logic Angiologiia i sosudistaia khirurgiia = Angiology and vascular surgery Anesteziologiya i Reanimatologiya Antibiotiki ... Moscow University Mathematics Bulletin . ... Moscow University Chemistry Bulletin . ... Mathematics - , . ... Physics, Chemistry, Mathematics Nauchno-Tekhnicheskaya Informatsiya. ...
[
Текст
]
Ссылки http://www.geol.msu.ru/vestnik/spisok_vak.pdf -- 350.9 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/vestnik/spisok_vak.pdf -- 350.9 Кб -- 08.04.2016 Похожие документы
... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...
[
Текст
]
Ссылки http://ccoe.msu.ru/sites/default/files/RU_Apps_Catalog_Sep13_LR.pdf -- 131.1 Кб -- 10.12.2013 Похожие документы
. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .
... 8 February , 2014 SAI seminar (Ryde et al 2010) 5 Thermal emission from GRB jet progenitor observer photon jet Photosphere (=1) · · · · Photons are not produced at the photosphere We have to calculate radiative transfer We need to know where the photons are produced We construct the expression for effective optical depth in relativistic flow considering random walk process in relativistic flow SAI seminar 6 8 ... 8 February, 2014 SAI seminar 28 ...
[
Текст
]
Ссылки http://master.sai.msu.ru/media/presentations/2014/20140208_Shibata.pdf -- 1131.7 Кб -- 07.02.2014 Похожие документы
... Point-split stress tensor and the Green's function. ... Casimir effect for a massless scalar field between two plates with the Dirichlet boundary conditions: one-particle states between the plates, explicit energy regularization and renormalization using the smooth cutoff. ... Casimir tension of a massless scalar field between two plates with the Dirichlet boundary conditions using the Green's function technique (the `pressure' Tnn version). ... Casimir energy renormalization. ...
[
Текст
]
Ссылки http://theorphys.phys.msu.ru/education/aqft_slides/ExamSyllabus_Term1.pdf -- 85.1 Кб -- 01.06.2015 Похожие документы
Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc -- 194.5 Кб -- 27.05.2015 Похожие документы
... Физический факультет МГУ, 2009 г. Кандидат физико-математических наук, 2012 г. Научные интересы: . ... Хвостов В. В., Гусева М. Б., Александров А. Ф., Тагаченков А. М., Стрелецкий О. А. Структурные и эмиссионные свойства аморфного линейно-цепочечного углерода. Краткие сообщения по физике ФИАН, 2012, Т. 39, ?2, с. 40-49 . ... Стрелецкий О. А., Хвостов В. В., Новиков Н. Д., Гусева М. Б., Александров А. Ф. Вторично-эмиссионные свойства пленок двумерно-упорядоченного линейно-цепочечного углерода.- ...
... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...
... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... Science . ... According to the fact that ecological conflicts has a global scale in international watersheds, transboundary location of Selenga river complicates the problem of scientific resolution of the conflicts between water consumers. ... International programme in Natural Resource Management and Law offers a unique combination of Natural and Environmental Sciences and Science of Law. ...
... The two main ways of financing a business, equity financing and debt financing, will be discussed in this chapter. Equity Financing Equity capital is the amount of money that you and/or your partners put into the business or raise from other investors. Equity is not debt. While investors share in the profits (or losses) of the business, their investment is not a loan. ... Debt Financing With your equity capital in place, you are now in a position to approach lenders for a business loan. ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/methodsforfinancingfourcompany.doc -- 102.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/methodsforfinancingfourcompany.doc -- 102.0 Кб -- 27.10.2005 Похожие документы
... Общая информация . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... Высшая школа инновационного бизнеса (факультет) МГУ имени М.В. Ломоносова (Корпоративный университет) создана в 2006 г. Объединяя ресурсы разных факультетов МГУ, Высшая школа видит своей задачей оперативную адаптацию классических университетских программ обучения к меняющимся запросам производства и развитие инновационных механизмов, обеспечивающих передачу на производство новых технологий ? ...
... For impatient users: You can download RusTeX in three different ways (Full installation; Selective download; Diskette-ready minimal installation) --- so at least read explanations about these methods before you download something. Please, use "Save link as" (right mouse button) for downloading files, otherwise .arj files and other binary files will be corrupted. ... TeX files are compact and readable in any text viewer: just text and commands for formatting and commands for equations drawing. ...
The Department of Talented Youth Affairs and Professional Orientation . ... Moscow State University opens the annual Summer School of Science and Education, Moscow State University ?Lanati? organized by Laboratory for scientific creativity AESC MSU. ... The school has a natural science bias. ... The feature of the school ?Lanati? is the fact that its participants can continue their education, taking advantage of the Moscow State University to enroll in AESC or study via distance technologies. ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...
... Borexino . ... SCIENCE AND TECHNOLOGY OF BOREXINO: A REAL TIME DETECTOR FOR LOW ENERGY SOLAR NEUTRINOS (pdf) . Solar neutrino experiments and Borexino perspectives (pdf) . Detection of Supernova Neutrinos by Neutrino-Proton Elastic Scattering (pdf) . BOREXINO: A REAL TIME LIQUID SCINTILLATOR DETECTOR FOR LOW ENERGY SOLAR NEUTRINO STUDY (pdf) . Confronting Spin Flavor Solutions of the Solar Neutrino Problem with current and future solar neutrino data (pdf) . ... CAN 2.0 стандарт (pdf) . ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы