... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... education . research . ... C 29 июня по 4 июля 2009 года пройдет I Международная летняя научная школа ?Нано2009. Наноматериалы и нанотехнологии в биологии и медицине? ... НОЦ по нанотехнологиям МГУ , Center for Drug Delivery and Nanomedicine, University of Nebraska Medical Center (США), Курчатовский институт , ?Московский центр трансфера технологий? ... Заканчивается прием тезисов на XII Международную конференцию по наноструктурированным материалам NANO 2014 (Москва, 13?18 июля 2014 года) . ...
... Лев Петрович Феоктистов . Лев Петрович Феоктистов родился 14 февраля 1928 года в семье служащих. ... Исследования Л.П. Феоктистова позволили также создать малогабаритные артиллерийские ядерные заряды большой мощности. ... С 1988 года и до конца жизни Л.П. Феоктистов заведовал отделом лазерного термоядерного синтеза Отделения квантовой радиофизики Физического института им П.Н. Лебедева. ... 2004 Кафедра физики атомного ядра и квантовой теории столкновений . ...
... 2009; 23: 12411248 Published online in Wiley InterScience (www.interscience.wiley.com) DOI: 10.1002/rcm.3994 Mass spectrometric study of peptides secreted by the skin glands of the brown frog Rana arvalis from the Moscow region T. Yu. ... The present work aims at establishing the primary structure of the peptides constituting the secretion of the skin glands of the common brown frog Rana arvalis from the Moscow region in Russia by means of mass spectrometry. ... Peptides 2004; 25: 1035. ...
APPLIED PHYSICS LETTERS 87, 241110 2005 Second- and third-harmonic generation in birefringent photonic crystals and microcavities based on anisotropic porous silicon I. V. Soboleva,a E. M. Murchikova, A. A. Fedyanin,b and O. A. Aktsipetrov Department of Physics, M. V. Lomonosov Moscow State University, 119992 Moscow, Russia Received 14 June 2005 ; accepted 22 September 2005 ; published online 6 December 2005 One-dimensional anisotropic photonic ... 2005 American Institute of Physics. ...
... 70, No. 4, pp. 12011218 c 2009 Society for Industrial and Applied Mathematics WEINSTEIN'S DIFFRACTION PROBLEM: EMBEDDING FORMULA AND SPECTRAL EQUATION IN PARABOLIC APPROXIMATION ANDREY V. SHANIN Abstract. A short-wave problem of reflection and radiation by an open end of a two-dimensional planar waveguide is studied. ... A recently developed approach based on the embedding formula and the "spectral" equation for the directivity of an edge Green's function is applied to the problem. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/weinstein09.pdf -- 284.6 Кб -- 14.03.2011
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/shanin_files/~shanin/papers/weinstein09.pdf -- 284.6 Кб -- 14.03.2011 Похожие документы
... Зорич Владимир Антонович . ... Профессор кафедры Математического анализа механико-математического факультета МГУ. ... Автор 85 математических работ (2012) и университетского учебника по математическому анализу для студентов физико-математических специальностей. ... Зорич В. А., Математический анализ задач естествознания , МЦНМО, М., 2008 . ... В.А.Зорич, Математический анализ задач естествознания. ... В.А.Зорич, Математический анализ (в двух томах: части I и II). ... В.А.Зорич, Математический анализ...
... The Council on Complex Problems of Cosmic Rays of the Russian Academy of Sciences and the Skobeltsyn Institute of Nuclear Physics (SINP) of Lomonosov Moscow State University are planning to held a workshop "Cosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century" on May 16-18 2011 at the Moscow State University. ... The Workshop banquet will be held on Tuesday, May 17 th . ... Workshop тАЬCosmic Ray Physics Large Scale Experiments at the Second Decade of the 21st Century"...
Московский государственный университет имени М.В.Ломоносова На правах рукописи Малькова Валентина Валерьевна УСТОЙЧИВЫЕ СРАВНЕНИЯ КАК СРЕДСТВО ВЫЯВЛЕНИЯ АССОЦИАТИВНОГО ПОТЕНЦИАЛА РУССКИХ И НЕМЕЦКИХ СЛОВ Специальность 10.02.20. - Сравнительно-историческое, типологическое и сопоставительное языкознание Диссертация на соискание ученой степени кандидата филологических наук Научный руководитель - доктор филологических наук, профессор Богданова Людмила Ивановна Москва 2014 ОГЛАВЛЕНИЕ
... ATOMS, MOLECULES, OPTICS Control of the Spectrum of the Biphoton Field K. G. Katamadze and S. P. Kulik Moscow State University, Moscow, 119992 Russia e mail: katamadze@inbox.ru, Sergei.Kulik@gmail.com Received June 11, 2010 Abstract--The main methods for controlling the biphoton field, as well as the problems for which the width and the shape of the spectrum of the biphoton field are of decisive importance, are discussed. ... vac + s where p is the pump frequency. ... Phys. 64, 012 306 (2001). ...
... On the Influence of Carbonic Acid in the Air upon the Temperature of the Ground. ... In order to get an idea of how strongly the radiation of the earth (or any other body of the temperature +15 ° C.) is absorbed by quantities of water-vapour or carbonic acid in the proportions in which these gases are present in ore" atmosphere, one should, strictly speaking, arrange experiments on the absorption of heat from a body at 15° by means of appropriate quantities of both gases. ... Mean Absolute Humidity....
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/geo/lectures-addons/04/1896%20Arrhenius.pdf -- 2025.1 Кб -- 03.03.2014 Похожие документы
2014 Titles.indd d Forum_1.indd Forum_1.in1 d 1 06.10.2014 22.10.2014 13:40 22.10.201419:55:48:08 13:40:08 Eighth International Forum «Partnership of State Authorities, Civil Society and the Business Community in Ensuring International Information Security» Ninth Scientific Conference of the International Information Security Research Consortium April 2124, 2014 Garmisch-Partenkirchen, Munich, Germany Forum_1.indd Forum_1.indd 2 Titles.indd 2 22.10.2014 13:40 22.10.2014 19:55:48:11 06.10.2014 13:40:11
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2014/Forum_1.pdf -- 2313.4 Кб -- 28.01.2015
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2014/Forum_1.pdf -- 2313.4 Кб -- 28.01.2015
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2014/Forum_1.pdf -- 2313.4 Кб -- 28.01.2015 Похожие документы
Cambridge University Press 0521835097 - High PT Physics at Hadron Colliders Dan Green Frontmatter More information HIGH PT PHYSICS AT HADR ON COLLIDERS This book provides a comprehensive introduction to high transverse momentum reactions at hadron (protonproton or protonantiproton) colliders. ... Cambridge University Press www.cambridge.org Cambridge University Press 0521835097 - High PT Physics at Hadron Colliders Dan Green Frontmatter More information Science is an integral part of culture. ...
... There are corresponding results showing that the Poincare duals of certain totally ge odesic cycles, which we will call "special cycles", span a definite part (a refined Hodge component) of the cohomology of the locally symmetric spaces of standard arithmetic type associated to the orthogonal groups O(p, q). ... Math. ... KLM3] (with B. Leeb and M. Kapovich) The generalized triangle inequalities in symmetric spaces and buildings with applications to algebra, Memoirs of the AMS, Vol. ...
[
Текст
]
Ссылки http://www.dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012
[
Текст
]
Ссылки http://dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012 Похожие документы
Inhibition of Horse Liver Alcohol Dehydrogenase by Methyltin Compounds Pavel V. Bychkov, Tatyana N. Shekhovtsova*, Elena R. Milaeva M.V. Lomonosov Moscow State University, Chemistry Department, Leninskie Gory, 119992 Moscow, Russia. ... The experimental results of the study show that inorganic tin and methyltin substances induce slight inhibition of the catalytic activity of horse liver alcohol dehydrogenase (HLADH), unable to be improved during pre-incubation with the enzyme. ...
[
Текст
]
Ссылки http://analyt.chem.msu.ru/kinetics/papers/Inhibition%20of%20Horse%20Liver%20Alcohol%20Dehydrogenase%20Bychkov%20191-%202005.pdf -- 932.8 Кб -- 25.09.2008 Похожие документы