Sorry, this page requires HTML-2.0 browser.

Еще в разделе: (Показать все результаты (>7) - optics.sinp.msu.ru/ )

• Speleofolklor

... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>11) - pk.math.msu.ru/ )

XXVIII General Assembly of the IAU, SPS15 Beijing, August 31, 2012 . N.N. Samus, S.V. Antipin "Variable Stars and Data-Intensive Astronomy" . During the 26th IAU General Assembly in Prague, the IAU Division V (Commissions 27 and 42) considered the future of variable-star catalogues. ... To discuss these problems and to look for their solutions, the IAU Commission 27, on behalf of the IAU Division V, created an informal working group, chaired by the GCVS editor, Dr. Nikolai Samus. ...

Еще в разделе: (Показать все результаты (>105) - sai.msu.ru/ )

• Презентация PowerPoint
• General Catalogue of Variable Stars: Variability Types
• International School "Frontiers in Numerical Gravitational Astrophysics"

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>5) - compmech.math.msu.su/ )

• Список публикаций - А. Н. Козлова - Кафедра вычислительной механики

... About hotel . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! ... Great stay! dns_support@antihotmail.com . ... Great hotel! ... best place in Murmansk that I've stayed! Add me to your mailing list for special offers . ... Stay was great. ... Always nice to have a good nights rest while enroute to my destinations. ... Very nice place . ... What a beautiful place, we enjoyed our stay! ... Best place ever! ... Your hotel was so nice. ...

Еще в разделе: (Показать все результаты (>3) - 69parallel.ru/ )

... Effective Presentations . ... Read the following abstract and summarize the main points . ... And on a personal level, the ability to move the audience can shape the trajectory of a manager's career. ... You may open the presentation with a joke to get the audience's attention. Even if you write out your entire speech beforehand, you'll undoubtedly work to sound informal and conversational, possibly posing a few questions directly to the audience throughout the talk. ... Subject / title of talk. ...

Еще в разделе: (Показать все результаты (>11) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ им.М.В.Ломоносова
• Факультет иностранных языков МГУ. Центр Дистанционного обучения.

... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...

Еще в разделе: (Показать все результаты (>2) - np-chair.sinp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

... Many of these planetesimals had metallic iron cores and during growth of the Earth this metal re-equilibrated with the Earth's silicate mantle, extracting siderophile (`iron-loving') elements into the Earth's iron-rich core. ... Chemical signature of core formation Growth of the Earth from planetary embryos and planetesimals resulted in the substantial partitioning of siderophile elements into the metallic core, leaving lithophile elements behind in the silicate mantle. ... REE, rare-earth elements....

Еще в разделе: (Показать все результаты (>12) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf
• http://ocean.phys.msu.ru/courses/geo/lectures-addons/02/2009%20Bromm%20et%20al.%2C%20The%20formation%20of%20the%20first%20stars%20and%20galaxies.pdf
• http://ocean.phys.msu.ru/courses/geo/lectures-addons/04/1896%20Arrhenius.pdf

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>2) - scon155.phys.msu.ru/ )

Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH­1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' ­ an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...

Еще в разделе: (Показать все результаты (>5) - top.sinp.msu.ru/ )

... H. Purcell: The Fairy Queen - Act V . ... In order to prove to Theseus that much stranger things happen than his disbelieving nature is willing to admit, Oberon now displays the full extent of his magic powers - Juno in a heavenly chariot drawn by peacocks, a paradisiacal Chinese garden (a real Garden of Eden) and finally even Hymen with his torch. The Spectacle ends with a grand ballet and a chorus of joy. ... Спектакль завершается грандиозным балетом и ликующим хором. ... For ever, ever free, . ...

Еще в разделе: (Показать все результаты (>21) - music.genebee.msu.ru/ )

• MSU Chamber Orchestra. Hystory.
• H. Purcell: The Fairy Queen - Act IV

... Конкурс У.М.Н.И.К. Объявления . ... Лучший молодой ученый года иљ . ... Конкурс научных работ молодых ученых МГУ (?Конкурс СМУ 2016?) Объявлен 40-й Конкурс научных работ молодых ученых МГУ, проводимый СМУ МГУ.љ ... 20 октября 2016 г. состоится полуфинальная конференция У.М.Н.И.К. 20 октября 2016 г. (ориентировочная дата) на Физическом факультете МГУ љ состоится полуфинальная конференция на получение премии поддержки молодых ученых У.М.Н.И.К. љ 20 октября 2016 г. состоится полуфинальный .. ...

Еще в разделе: (Показать все результаты (>4) - smu.physics.msu.ru/ )

... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...

Еще в разделе: (Показать все результаты (>2) - dubrovinlab.msu.ru/ )

... Home News Colloquium on 10.04.08 . ... Voskov A.L., Uspenskaya I.A. "The phase diagram Cu-Gd calculation" . Nikolaeva L.S., Semenov A.N., Mamontov M.N., Feofanova M.A. "Calculation of chemical equilibria in the systems CaCl 2 -heparin-adenosine triphosphate and MgCl 2 -heparin-adenosine triphosphate inљthe physiological solution medium". ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• Lora S. Nikolaeva Laboratory of Chemical Thermodynamics
• PhDi Laboratory of Chemical Thermodynamics
• Colloquium on 14.06.12 Laboratory of Chemical Thermodynamics

... Parasitized females still produce eggs, but because juvenile development occurs inside the female marsupial brood pouch, young gammarids experience the same risk of predation as their mother until they exit the marsupium. ... Contrary to our expectation, we observed the opposite result, that is, juveniles from parasitized females exited the marsupial brood pouch significantly later than did those from uninfected ones. ... Females were kept if both partners were infected. ...

Еще в разделе: (Показать все результаты (>32) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2007_Bonferroni_JOB.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2008_R0r_EcolMod.pdf