General Utility Lattice Program Version 4.0 Julian D. Gale Nanochemistry Research Institute, Department of Chemistry, Curtin University, P.O. Box U1987, Perth, WA 6845, Australia email: gulp@ivec.org 1 Chapter 1 Introduction & background The General Utility Lattice Program (GULP) is designed to perform a variety of tasks based on force field methods. The original code was written to facilitate the fitting of interatomic potentials to both energy surfaces and empirical data. However, it has expanded now to
... О факультете . ... Heng Zhang, Lei Li, Martin M?ller, Xiaomin Zhu, Jaime J. Hernandez Rueda, Martin Rosenthal, and Dimitri A. Ivanov*// From Channel-Forming Ionic Liquid Crystals Exhibiting Humidity-Induced Phase Transitions to Nanostructured Ion-Conducting Polymer Membranes "// Advanced Materials 25 (2013) 3543-3548. ... МГУ имени М.В.Ломоносова; авторы Герасин В.А., Иванов Д.А., Антипов Е.М. , Князев Я.В., Антипова Л.А., Гусева М.А. Список статей, опубликованных членами трудового коллектива . ...
... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....
... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf -- 136.3 Кб -- 06.07.2014 Похожие документы
... THE TIME HAS COME FOR "THUNDER BOOKS" . ... You may have forgotten what a thunder book is, or maybe you didn't ever use that name. ... It is a handy reference to those things you need to know about soils and how they behave. ... Well, if you knew how to use them as pages in a thunder book it would surely be a good start, but you need something uniquely yours. ... It has always been my belief that the mission of a soil survey is to help people understand and wisely use soil resources. ... Good read. ...
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... The circular sidewall of the layer was made of plexiglass. ... This is in contrast to the situation of horizontal layer where longitudinal magnetic field doesn't influence on convective instability and only renders oriented effect [8,10]. [ pic ] Figure 6 Stability boundaries of thermally driven shear flow in an inclined ferrofluid layer in the presence of a longitudinal magnetic field : a - shear flow ; b - convection rolls aligned with the shear flow ; c - convection ...
... Department . ... Contacts . ... The department offices are at the 6th and 7th floor in the Lomonosov MSU 2nd educational building (Faculty of Computational Mathematics and Cybernetics): 714 (scientific secretary of the department), 615a (head of the department), 666, 717. ... CMC Faculty at Google Maps and Yandex.Maps . ... Scientific secretary of the department, Assoc. ... Deparment of the Automation for Scientific Research (ANI) . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...
Symbolic circuit-matrix processor and evaluator . Authors: Filaretov V.V., Shein D.V. (Ulyanovsk State Technical University, Russia) . SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... English documentation: . ... Symbolic circuit processor . ... Symbolic matrix processor . ... Complex evaluator . ...
... СУНЦ МГУ . ... Краткая информация . ... Материалы экзаменов 1-го тура прошлых лет . ... Кафедры . ... Сотрудники . ... Кафедра химии . ... Сезонные школы СУНЦ МГУ . ... Олимпиадные сборы СУНЦ МГУ . Интернет-ресурсы СУНЦ МГУ . ... Заочная школа СУНЦ МГУ . ... Главная Подразделения Кафедры Кафедра химии Chemistry Chair . Chemistry chair of AESC MSU was founded at 13 November 1989 by professor of MSU Chemistry department Yu. ... Natalia Igorevna Morozova, docent, PhD (Chem.) ... Chemistry Chair . ...
... Теория . ... Исследование свойств материи при столкновениях элементарных частиц и ядер на современных ускорителях высоких энергий (Д.ф.-м.н. Боос Эдуард Эрнстович, зав. отделом экспериментальной физики высоких энергий НИИЯФ МГУ, тел. 939-30-64, e-mail: boos@theory.sinp.msu.ru) . ... Исследования по квантовой теории поля и анализ данных на установке LHCb (Доцент Никитин Николай Викторович, доцент кафедры и ст. науч. сотр. ... Copyright 2004 Кафедра физики атомного ядра и квантовой теории столкновений...
... Студенческая Астрономическая обсерватория ГАИШ . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... For those really interested in galaxies, extragalactic astronomy or the aspects of cosmology we study, we can always find an interesting problem to work on. ... To make your work in the Group most effective, it would be useful to study the following courses read by our group members as well as the members of other groups in our and other institures. ... Student information . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Полиароматические гидрокарбоны в донных отложениях Баренцева моря: динамика за последние 10 лет. ... Сравнение двух групп данных, полученных в указанные выше периоды времени, показало незначительную разницу между средним значением концентраций и составом PAHs в донных отложениях в 3-х исследуемых участках Баренцева моря. В юго-западной части моря средняя общая концентрация PAHs, полученная в девяностые годы, также незначительно отличается от данных, полученных в двухтысячные годы. ...
... Business Address: Quantum Electronics Division, Physics Department, Moscow State University, Moscow 119992, Russia . ... 7 495 9393669 . Fax: +7 495 9391104 . ... Education: M.S., Physics, Moscow State University, 2003, with honor . Diploma work: Second harmonic generation by multiple quantum wells silicon/ oxide of silicon . ... Nonlinear optics and microscopic properties of multiple quantum wells Awards: "Grant of Moscow" for the best students in Physics (2002) . ... Phys. B 74, 671 (2002). ...
... Bohm limit DB=vrg/3: Emax Emax ush 0.3 Ze B Rsh c 1014(B/Bism) Z eV B Hillas criterion ! ... Voelk 2000; Kang Jones 2006) - Bohm diffusion in amplified magnetic field B2/8 = 0.035 u2/2 ( Voelk et al. 2005 empirical; Bell 2004 , Zirakashvili VP 2008 theoretical) - account for Alfvenic drift w = u + Va upstream and downstream - relative SNR rates: SN Ia : IIP : Ib/c : IIb = 0.32 : 0.44 : 0.22 : 0.02 Chevalier 2004 , Leaman 2008, Smart et al 2004, Berezinsky et al 2006 Das et al. ...
The head of the team - Vladimir A.Veselovsky , Professor of Biophysics . ... M.V.Lomonosov State University, Moscow, Russia . ... Induced by different factors (light, H 2 O 2 , KMnO 4 , electric current etc.) luminescence of roots and leaves was used for investigation of mechanisms of damage in cells and for plant resistance determination. ... Moscow. Znanie (in Russian). 1964. 48 p. Tarusov B.N., Veselovsky V.A. Ultra Weak Light Emission of Plant and its Practical Significance. ...