... A comparative study of thermodynamic for both natural and artificial RNA/DNA protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf -- 140.7 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/bioelectro2002.pdf -- 140.7 Кб -- 18.02.2008 Похожие документы
... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...
... The "Mulliken" AMMs up to the fourth order were calculated within the scheme developed by Saunders et al. [13] using the B3LYP, Perdew-Wang (PW91), and Perdew-BurkeErnzerhof (PBE) functionals with the 6-21G** basis set (for shortness, noted below basis set 3 or BS3) for all ALPOs, while the ATN and ATO structures were also considered at other levels as STO-3G (BS1), 3-21G (BS2), and 8-511G*(Al)/8-521G*(P)/8411G*(O) (BS4) for comparison. ... No EP convergence with the basis set was observed. ...
... Seismic Nails in Various Geodynamic Conditions V. S. Zakharov, A. I. Karpenko, and S. P. Zav'yalov Faculty of Geology, Moscow State University, Moscow, 119899 Russia e mail: vszakharov@yandex.ru, AlexandroKarpenko@yandex.ru, zasergey@rambler.ru Received May 25, 2012 Abstract--Isometric in plan, near vertical earthquake clusters (seismic "nails") were identified in different regions of the world. ... Some nails are related to strong earthquakes and volcanic erup tions. ... The initial formation was...
[
Текст
]
Ссылки http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_etal_2013_eng.pdf -- 425.2 Кб -- 27.03.2013 Похожие документы
... Laboratory of Problems for Magnetism, . ... Study of the magnetic and transport properties of R-3d intermetallic compounds with a magnetic instability of the itinerant-electron subsystem. ... const at high temperatures (Curie-Weiss law) [A.S. Markosyan, Y. Hosokoshi, K. Inoue, Phys. Lett. ... Gaidukova, Y. Hosokoshi, K. Inoue, A.S. Markosyan , Magnetic phase diagram and pressure effect on the magnetic properties of the Y 1? x Gd x Mn 2 intermetallic compounds, J. Phys.: Condens. ...
ITPM MSU . Quantum Computing Page . ... Quantum Computation/Cryptography at LosAlamos . Quantum Information at Los Alamos National Laboratory . Laboratory for Theoretical and Quantum Computing ( Universite de Montreal ) . Quantum information and quantum computation at IBM . ... Centre for Quantum Computation . Quantum Information Page . Quantum Information and Computation . ... Quantum Information and Quantum Computing (by Reinhard F. Werner) . ... c) ITPM MSU 1998, 1999 ...
30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/global2007.pdf -- 136.8 Кб -- 19.03.2008 Похожие документы
... Флогистон / konservator . ... Сайт: http://juliana-puchkova.ru/ . ... Основной метод - аналитическая психология (юнгианский анализ), в том числе толкование сновидений и песочная терапия. ... В 2009-2010 г.г. - участник методического семинара Е.А. Пуртовой (разработка авторской программы по развитию символического мышления у психологов, психотерапевтов, аналитиков). ... Что такое юнгианская супервизия?". - журнал Высшей школы психологии "Юнгианский анализ", ?1, 2010. ( http://www.maap.ru/learn/38/ ) ...
... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Патент Список статей за 2011 год. ... 73, Iss. 3, 2011, p.117 -124. ... Antipov S.D., Gorunov G.E., Perov N.S., Pivkina M.N., Said-Galiyev E.E., Semisalova A.S., Stetsenko P.N. «Ferromagnetic behavior of Pt nanoparticles», Abstracts of Moscow International Symposium on Magnetism, 2011, Moscow, p. 118. ... Samsonova V., Rodionova V., Koptsik S., Perov N. «Relation of soil magnetic properties with industrial pollution», Abstracts of Moscow International Symposium on Magnetism, 2011, Moscow, p. 774. ...
[
Текст
]
Ссылки http://magn115.phys.msu.ru/Rus/labs/mmrlab-publications-2011.doc -- 98.5 Кб -- 01.10.2012
[
Текст
]
Ссылки http://magn.phys.msu.ru/Rus/labs/mmrlab-publications-2011.doc -- 98.5 Кб -- 01.10.2012 Похожие документы
... Furman and A.V.Tikhonravov, "Basics of optics of multilayer systems" , Editions Frontiers, Gif-sur Yvette, 1992, 242 p. A.V. Tikhonravov, M.K. Trubetskov, I.V. Zuev and P.G. Verly, "Efficient Refinement of Inhomogeneous Optical Coatings", in "Optical Interference Coatings", OSA Technical Digest Series, vol. ... A.V. Tikhonravov, M.V. Klibanov, I.V. Zuev, "Numerical study of the phaseless inverse scattering problem in thin film optics", Inverse problems, 1995, Vol. 11, pp. ... Основные публикации . ...
. If you see this page, the nginx web server is successfully installed and working. Further configuration is required. For online documentation and support please refer to nginx.org . Commercial support is available at nginx.com . Thank you for using nginx.
... Hello everybody out there using minix - I'm doing a (free) operating system (just a hobby, won't be big and professional like gnu) for 386(486) AT clones. ... I'd like any feedback on things people like/dislike in minix, as my OS resembles it somewhat (same physical layout of the file-system (due to practical reasons) among other things). ... This implies that I'll get something practical within a few months, and I'd like to know what features most people would want. ...
SKOBELTSYN INSTITUTE OF NUCLEAR PHYSICS (SINP) A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION MAGNET FOR 55 MeV RACE TRACK MICROTRON MSU-SINP Preprint No 2011-2/866 1 UDC 621.039 A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov E-mail addresses: shved@depni.sinp.msu.ru DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION ... Magnetic screen system optimization.. ...
... 4, No. 5 (2006) 10331056 c Imperial College Press RECOGNITION OF TRANSMEMBRANE SEGMENTS IN PROTEINS: REVIEW AND CONSISTENCY-BASED BENCHMARKING OF INTERNET SERVERS NATALIYA S. SADOVSKAYA Institute for Information Transmission Problems, Russian Academy of Science Bolshoi Karetny per. ... Landolt-Marticorena C, Williams KA, Deb er CM, Reithmeier RA, Non-random distribution of amino acids in the transmembrane segments of human typ e I single span membrane proteins, J Mol Biol 229(3):602608, 1993. ...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...