M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o љ44'.767љN; Longitude = 42 o љ31'.417љE; Altitude = 2067љm MASTERљIIљ(8љsquareљdegress) + MASTERљVWF(VeryљWideљFieldљCameras (FOV=800 square degrees, Timeљresolutionљupљtoљ150љms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...
... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...
... Кафедра иммунологии Биологического факультета . ... Страница памяти А.А. Ярилина . ... Опубликовано 16/04/2011 20/04/2011 Рубрики immunology-today Добавить комментарий к записи Лекции Тома Хамильтона 21 и 22 апреля . ... Опубликовано 02/12/2010 29/06/2011 Рубрики immunology-today Добавить комментарий к записи Как Т-клетки узнают антиген . ... Опубликовано 20/09/2010 25/09/2010 Рубрики immunology-today Добавить комментарий к записи Научный семинар в рамках курса ?Актуальные проблемы иммунологии? ...
... He was graduated from Moscow State University, Faculty of Mechanics and Mathematics, and post-graduate course in a speciality Theory of Probabilities and Mathematical Statistics. ... Ph.D in mathematics in 1980 (Moscow State University, Faculty of Computer Science). ... Author of Popular Textbooks on Data Analysis and Statistics. ... He was graduated from Moscow State University in 1980. Ph.D in mathematics in 1988 (Moscow State University, Faculty of Mechanics and Mathematics). ... InCo . ...
Conference . ... 3rd Announcement . 2nd Announcement . ... The 2006 autumn IVOA Interoperability Meeting and Small Project Meeting will be held in Moscow, Russia, from September 18-22. The venue for the meeting are Institute of Astronomy, Sternberg Astronomical Institute and Headquarter of the Russian Academy of Sciences. ... Working Groups: VOTable, UCDs, Registry, Data Models, Data Access Layer, VO Query Language, Grid and Web Services, and VOEvent. Interest Groups: Applications, Theory. ...
... GPU Center of Excellence МГУ . ... NVIDIA предлагает вам пройти бесплатные online курсы по программированию массивно-параллельных процессоров. ... Тем, кто продемонстрирует высокие показатели при прохождении заданий курса, предлагается бесплатная сертификация по программированию GPU, поддерживающих технологию CUDA, в учебном центре Applied Parallel Computing. Краткое содержание курса: . Лекция 1. Введение в CUDA. ... Модель исполнения CUDA. ... Прикладные CUDA библиотеки. ...
Lomonosov Moscow State University Biological faculty Botanical garden (Russia, http://botsad.msu.ru) Botanical garden of the Komarov Botanical institute (Russia) Russian Iris Society Botanical garden of Taurida National Vernadsky University (Ukraine) The first information letter Dear colleagues! ... Wide range of topics concerning representatives of genus Iris L. are planned to be discussed at the following sections: 1. ... Abstract submission deadline is Apr.1, 2011. ... Rodionenko G.I. Genus Iris. ...
[
Текст
]
Ссылки http://www.botsad.msu.ru/docs/eng_iris1.doc -- 440.0 Кб -- 20.02.2011
[
Текст
]
Ссылки http://botsad.msu.ru/docs/eng_iris1.doc -- 440.0 Кб -- 20.02.2011 Похожие документы
системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи, базы данных, информационные технологии, технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование , математическое моделирование , вычислительный эксперимент, информатика, методы вычислений, численный анализ, ...
... Сотрудники . ... Научная работа . ... Сверхпроводимость вызывает огромный интерес, т.к. передача электрического тока без энергетических потерь сулит огромные перспективы. Актуальность поиска соединений для электрохимической интеркаляции мультивалентных катионов, также как и разработки фундаментальных основ кристаллохимического дизайна таких соединений, связана с возрастающими потребностями в легких высокоэффективных возобновляемых химических источниках тока (ХИТ). МГУ им. М.В. Ломоносова . ...
SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...
... по всему сайту по геол. сайтам в каталоге в форумах в словаре в конференциях . ... Конференции: Календарь / Материалы . ... Геология >> Геофизика | Анонсы конференций . ... 13.10.2003 | А.Б. Кирмасов . РОССИЙСКАЯ АКАДЕМИЯ НАУК КАРЕЛЬСКИЙ НАУЧНЫЙ ЦЕНТР ИНСТИТУТ ГЕОЛОГИИ Петрозаводск, 1317 октября 2003 XIV Молодежная научная конференция, посвященная памяти члена-корреспондента АН СССР К.О.Кратца "ГЕОЛОГИЯ И ГЕОЭКОЛОГИЯ СЕВЕРО-ЗАПАДА РОССИИ" ПЕРВЫЙ . ... Тематика совещания: Геология и . ...
... Инновационная . структура МГУ . ... деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... In the commercial world, the business manager (entrepreneur, Chief Executive Officer (CEO), Chief Operating Officer (COO):) must create the infrastructure and face many issues specific to the establishment and development of a new company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...
... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...
30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/global2007.pdf -- 136.8 Кб -- 19.03.2008 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . ... dedicated to the outstanding Russian scientists . ... Moscow, April 10-14, 2007 Welcome . ... Dorodnicyn Computing Center of RAS, Computational Mathematics and Cybernetics Faculty of the M.V.Lomonosov Moscow State University and Russian Scientific Operations Research Society will organize the Vth Conference in April 2007 in Moscow. ...
... COMMONWEALTH OF INDEPENDENT STATES (CIS) CHAPTER . ... Dept. of Chemistry, Lomonosov Moscow State university, Leninskie Gory, 119992 Moscow, Russia . ... Dept. of Chemistry, Lomonosov Moscow State University, Leninskie Gory, 119992 Moscow, Russia . ... Danchenko Natalya Nikolaevna, Dr. Dept. of Geology, Lomonosov Moscow State University, Leninskie Gory, 119992 Moscow, Russia . ... 7(095)2308037 . ... Dept. of Physics, Lomonosov Moscow State University, Leninskie Gory, 119992 Moscow, Russia . ...
... This computer belongs to the Laboratory of Condensed Matter Theory . at the Department of Low Temperature Physics , the Faculty of Physics, . M.V.Lomonosov Moscow State University, Moscow, 119992, RUSSIA. The head of the group is Professor Alexey Dmitriev. Assosiated Professor: . ... Main research directions of the group include: . ... low dimensional structures; . ... Computer science. ...
... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...