LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ AMPLITUDE EVOLUTION AND RUNUP OF SOLITARY WAVES ON A SLOPING PLANE Ahmet . ... 1999]; Carrier and Yeh, [2002]. ... Experimental data on runup of solitary waves are given among others by Hall and Watts, [1953], Pedersen and Gjevik, [1983] and Synolakis [1987], Shankar and Jayaratne, [2002], Lee and Raichlen, [2002]. ...
. Евгений Вареник, 28 февраля 2006 . Схема Горнера вычисления значения полинома в точке. Доказательство ее оптимальности в худшем случае по числу операций "сложение" и "умножение" среди алгоритмов, использующих только эти операции. Материалы к докладу: . E.M. Reingold and A.I. Stokes, Simple proofs of lower bounds for polynomial evaluation, in: R.E. Miller and J.W. Thatcher, Eds., Complexity of Computer Computations (Plenum, New York, 1972) 21--29.
. Область научных интересов . Сотрудники, приглашенные специалисты и студенты . Информация о научных конференциях и семинарах . Основные публикации . Наш адрес . Home page .
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
... немецкий химик, член Берлинской Академии наук . Цирконий (лат. ... Известно пять природных изотопов циркония: 90 Zr (51,46%), 91 Zr (11,23%), 92 Zr (17,11%) 94 Zr (17,4%), 96 Zr (2,8%). В 1789 году немецкий химик М. Г. Клапрот в результате анализа минерала циркона выделил двуокись циркония Порошкообразный цирконий впервые был получен в 1824 году И. Берцелиусом, а пластичный - в 1925 году нидерландскими учеными А. ван Аркелом и И. де Буром при термической диссоциации иодидов циркония. ...
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...
... The 2016 Beacon Satellite Symposium will be held at the International Centre for Theoretical Physics (ICTP) at Trieste, Italy, from 27 June to 1 July 2016. ... Абстракты - 15/02/2016 . Подробнее на сайте: http://t-ict4d.ictp.it/beacon2016 . Конференция "Распространение радиоволн" имеет более чем 40-летнюю историю и проводится раз в два-три года в центральных городах России. 15 декабря 2015 г. - начало регистрации участников и представления текстов докладов . ... D.Физика атмосферы . ...
... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...
Discover the cosmos! ... 2000 December 29 . The Dark Horsehead Nebula . ... Image Processed by Al Kelly . Explanation: While drifting through the cosmos this magnificent interstellar dust cloud, sculpted by stellar winds and radiation, has chanced to assume a recognizable shape. Fittingly named The Horsehead Nebula it is embedded in the immense complex of star forming gas and dust surrounding the Orion Nebula some 1,500 light-years distant. ... About APOD | ...
... For full UV energy Euv (erg) radiated in TLE the corresponding number of photons of wavelength =300-400 nm (with average energy 3.5 eV) is: Nph=Euv/3.5в1.6 10-12 (1) We considered 2 options of the pinhole camera focal distance: 1. focal distance is short so that the circle of diameter 40 km is observed by one pixel and 2. focal distance is long so that the 40 km circle is observed in many camera pixels. ... Full energy released in UV in the atmosphere is determined by the pixel signal. ...
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/Ponce2007fin.pdf -- 115.3 Кб -- 19.03.2008 Похожие документы
Federation of European Societies on Trace Elements and Minerals PRELIMINARY SCIENTIFIC PROGRAM 09.06.2010 SESSION 1. Trace element and mineral analysis of environmental and biological samples: bulk determination, speciation and quality control. ... 10.06.2010 SESSION 2. ... SYMPOSIUM ORGANIZATION Venue The 4th International Symposium on Trace Elements and Minerals in Medicine and * Biology will take place in the Hotel "Okhtinskaya" (4, Bolsheokhtinsky prospect, 195027 St.Petersburg, Russia). ...
[
Текст
]
Ссылки http://www.fbm.msu.ru/sci/sno/conf/russia/IV%20FESTEM%20Symposium.pdf -- 315.9 Кб -- 26.12.2009 Похожие документы
... x25BA; Courses . x25BA; Integrated course . Search courses: . Course categories: Integrated course Integrated course / Teaching with Technology Integrated course / Teaching with Technology / Курсы повышения квалификации Integrated course / Teaching with Technology / Курсы повышения квалификации / English Language Courses Разное . ... Управляющий: Алла Леонидовна Назаренко . ... Students will utilize Moodle, an online course management system, as they work to complete the project.љ ...
THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Reactivity thermoelectric clathrate compounds in interaction with components of the air . The project aims to address the fundamental problems of solid state chemistry - revealing the fundamental regularities of the reactivity of crystalline phases in reactions with air components and processes of formation of oxide layers (coatings) for new materials. ...
... Полная версия: Технические работы на сервере . Грация-МГУ::Форум > Общение > Другая жизнь . ... Apr 14 2011, 00:01 . ... сегодня весь день на сервере будут проводиться технические работы. ... Subject: Internet cleaning.....very important.. ... hours in order to allow us to clean it. ... Internet. ... Internet users has grown dramatically. ... to other sysops and Internet users as well. ... Internet users has grown dramatically. вопщем, очистка интырнетов это прекрастно во всех отношениях, ящитаю . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
FNAL SELEX experiment. ... Моя Atlas страница здесь, в МГУ. ... Страница памяти Юрия Александровича Лазарева . ... Л.Д. Ландау ? ученый, учитель, человек?(.pdf) . ... Круг Ландау: Физика войны и мира?. 2009 г., 269 стр.) ... Л.Д. Ландау?(.pdf) . 32 стр.) ... Бонсай в Москве, декабрь 2015 г. Южная Индия в январе 2011 г. Петербург в ясном октябре 2010 г. Фото на станции метро Лубянка после теракта 29 марта 2010 г. (30 марта и 6 апреля). ... Фото Гелл-Манна , выступавшего в МГУ 25.09.2007. ...