... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>10) - mouse.belozersky.msu.ru/ )

• SVETKA, a program for multiple sequence alignments analysis
• Geometrical core

... The S.P.Novikov Seminar came into being in the mid-sixties. ... 1] L.A.Alaniya, On manifolds of the Alexander type// Uspekhi Mat. Nauk, V. 46 ,1991, P. 179-180. ... Nauk SSSR, V.43, 1979, P. 104-240. ... 11] V.M.Bukhshtaber, A.S.Mishchenko, S.P.Novikov, Formal groups and their role in the apparatus of algebraic topology// Uspekhi Mat. ... Some applications to differential topology and to the theory of characteristic classes// Izv.Akad.Nauk SSSR, V. 34, 1970 I N2, P. 253-288; II: N3, P. 475-500. ...

Еще в разделе: (Показать все результаты (>120) - higeom.math.msu.su/ )

... О факультете . ... Master In Ecology . Master In Nanobiotechnology . ... Nanobiotechnology and Biophysics? is intended for prospective highly qualified professionals with in-depth knowledge in of modern biophysics, molecular biology and nanobiotechnology. ... The program is focused at problems of modern nanobiotechnology, biophysics and proteomics, and hence it consists of the two parts: lectures/seminars and laboratory work. ... Lectures / Practical . ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>5) - www.bio.msu.ru/ )

• Master In Ecology ? Биологический факультет МГУ

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>2) - scon155.phys.msu.ru/ )

Cell Biology International 27 (2003) 293­294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>36) - cellmotility.genebee.msu.ru/ )

• Alieva Irina
• Smurova Xenia
• Tvorogova Anna

... 1967-1972: Undergraduate: M.V. Lomonosov Moscow State University, Department ofТљMechanics and Mathematics. ... 1980-1987: The Deputy Dean for science and research, Department ofТљMechanics and Mathematics, M.V. Lomonosov Moscow State University . ... 1997-2001: The Deputy Minister ofТљthe Education ofТљthe Russian Federation . ... since 2003: Head ofТљDepartment ofТљMechanics, Steklov Mathematical Institute, Russian Academy ofТљSciences . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>121) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Erdakova Nadezhda Nikolaevna

English-speaking countries» Test Your Knowledge of Great Britain 2009 © - ©.. ... 49 4 GEOGRAPHY 1) How many parts does Great Britain consist of? a) 5; b)4; c)6; d)3. 2) What is the area of Great Britain ? ... 9)What is the name of the river flowing along the border of England and Scotland? a)the Tweed; b)the Severn; c)the Great Ouze; d)the Eden. ... 26) How many animal species are there in Great Britain? a) over 40,000; b)30,000; c)35,000; d)12,000. ... British colonies. a)8; b)5; c)10; d)13. ...

Еще в разделе: (Показать все результаты (>27) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Model_rendering.pdf
• http://www.eng.math.msu.su/download/Academic_English_4.pdf
• http://www.eng.math.msu.su/download/Academic_English_part2.pdf

... 2009 тАФ Ph.D. in General History (Institute of General History, Russian Academy of Science, Moscow) . ... The mid-French Literary Text: Transition from Manuscript to Incunabula Form and its XV-century Readers. 1995 тАФ MS in the History of Medieval France (Moscow State University, History Department ) . ... Training course in anthropology and cultural studies . ... Central State Museum of the Cinema, Moscow (2009 тАФ to date) . ... State University for Human Sciences, Moscow (2008 тАФ to date) . ...

Еще в разделе: (Показать все результаты (>7) - discours.philol.msu.ru/ )

• Summer School Archives
• Tatiana Venediktova

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>15) - sbmg.geol.msu.ru/ )

• Ф-502

... 2 What is MATLAB ?? Basic Matrix Operations Script Files and M-files Some more Operations and Functions APPLICATIONS: Plotting functions .. ... Vectors are special forms of matrices and contain only one row OR one column. Scalars are matrices with only one row AND one column MATLAB Matrices 17 A matrix with only one row AND one column is a scalar. A scalar can be created in MATLAB as follows: » a_value=23 a_value = 23 MATLAB Matrices 18 A matrix with only one row is called a row vector. ...

Еще в разделе: (Показать все результаты (>12) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/files/courses/ipintro2012/sample_code.m
• http://imaging.cs.msu.ru/files/courses/ipintro2012/Lec_Pt3_inpaint_my.pdf
• http://imaging.cs.msu.ru/pub/2013.PRIA.Mamaev_Lukin_Yurin.HermiteNLM.en.pdf

... The surface mixed layer of the ocean is often characterized by density compensation between the horizontal temperature and salinity gradients. ... The coupling arises through a nonlinear diffusion operator proportional to the buoyancy gradient, which parameterizes the combined effect of slumping and mixing of small-scale horizontal buoyancy gradients. ... Mesoscale stirring will create small-scale temperature and salinity gradients by stretching and folding the large scale thermohaline patterns. ...

Еще в разделе: (Показать все результаты (>13) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf

Red Square at Night . The guide books were wrong when they told me that Moscow is dreary in November. ... The sound stands in contrast with the enormous bustle of Moscow. I teach in the Humanities building, a large rectangular steel and glass mirror just out of the shadow of the skyscraper that symbolizes Moscow State University. Getting in and out of the Humanities building means edging into a fast-moving stream of students and faculty who are hustling to class. ...

Еще в разделе: (Показать все результаты (>23) - suny.msu.ru/ )

• Center on Russia and the United States :: SUNY Russian Programs
• Center on Russia and the United States :: Summary of SUNY/MSU Center Activities
• Center on Russia and the United States :: Currently available grants

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

THE JOURNAL OF CHEMICAL PHYSICS 133, 144101 2010 Effective numbers of modes applied to analysis of internal dynamics of weakly bound clusters A. A. Rybakov,a E. D. Belega, and D. N. Trubnikov Department of ... Russia Received 11 June 2009; accepted 14 September 2010; published online 11 October 2010 The dependence of the volume of the chaotic component in the internal dynamics of triatomic van der Waals clusters on the angular ... When such difference is small, the regular motion disappears. ...

Еще в разделе: (Показать все результаты (>16) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/sotrudniki/larin/CC_EF1f.doc
• http://beams.chem.msu.ru/doc/Dynamical_systems_Theory_and_applications.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/IJIM99.pdf

... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...

Еще в разделе: (Показать все результаты (>5) - www.students.chemport.ru/ )

Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...

Еще в разделе: (Показать все результаты (>3) - cell.biophys.msu.ru/ )

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

260. staff:guterman:grants_engl.html | Кафедра высшей алгебры