... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>13) - erp.cmc.msu.ru/ )

Application of Kingdon, Penning and Paul ion traps for determination of protein mixture compositions and protein primary structures Nikolaev Evgenij N. The Institute for Biomedical ... Academy of Sciences The Institute for Energy Problems of Chemical Physics Russian Academy of Sciences ennikolaev@rambler.ru Kingdon, Penning and Paul ion ... Penning trap is a Paul trap (frequently with cylindrical instead of hyperbolic electrodes) in magnetic field applied parallel to the trap axes. ...

Еще в разделе: (Показать все результаты (>86) - www.msm.biophys.msu.ru/ )

• MSM 2007

... Курс обеспечивает интенсивный обзор тем по физиологии роста и развития растений, сосредотачиваясь на геномных, аналитических, вычислительных и других высоко-информативных современных подходах, необходимых для понимания биологии развития растений. Курс дает представление о генетических, молекулярных и биохимических механизмах, определяющих рост и развитие растений, включая механизмы спецификации клеток, клеточную организацию, морфогенез и формирование тканей и органов. ... Ритмы роста растений. ...

Еще в разделе: (Показать все результаты (>9) - plantphys.bio.msu.ru/ )

Regular Maps and Their Groups H. R. Brahana American Journal of Mathematics, Vol. ... In the one case the number of regions of the map is equal to twice the order of the group and in the other the number of regions is equal to the, order of the group divided by the number of sides of a region. ... The Group of a Regular Map. ... Noting that there exists no group of order 40 and degree 8, we have the result that there exists no regular map of ten 4-sided regions on - a surface of genus two. ...

Еще в разделе: (Показать все результаты (>35) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/papers-sym/conder.pdf

... Таня Трубичева, Коля Чеботарев, Сергей Меженный, Андрей Лебедев . ... Слева направо: Паша Зинюков, Булат Мавлюдов, Галя Ивутина (выше), Муся Григорян, Саша Игнатьев. ... Слева направо: 1)Аня Ноздрачева, 2)Дима Китаев, 3)Миша Ноздрачев, 4)Женя Цибиков, 5)Костя Фирсов, 6)Володя Трифонов, 7)Тамара Голубицкая, 8)Таня Михайлина, 9)Саша Игнатьев, 10)Валя Рябинкина, 11)Таня Чеботарева, 12)Оля Гусева, 13)Коля Чеботарев. ... Таня Гужва, Таня Немченко, Даниэль Усиков перед спуском в снежную . ...

Еще в разделе: (Показать все результаты (>10) - optics.sinp.msu.ru/ )

• polist99
• zagedan

Optical imaging of fluorescent carbon biomarkers using artificial neural networks Tatiana A. Dolenko Sergey A. Burikov Alexey M. Vervald Igor I. Vlasov Sergey A. Dolenko Kirill A. Laptinskiy Jessica M. Rosenholm Olga A. Shenderova Downloaded From: http://biomedicaloptics.spiedigitallibrary.org/ on 12/17/ 2014 Terms of Use: http://spiedl.org/terms Journal of Biomedical Optics 19(11), 117007 (November 2014 ) Optical imaging of fluorescent ... Results of Using Artificial Neural Networks Fig. ...

Еще в разделе: (Показать все результаты (>24) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/en/articles/2014/Nanosystems_CD_ANN_2014.pdf
• http://rswater.phys.msu.ru/en/articles/2014/Carbon%20dots%20ND%20ppsc201300251.pdf
• Laboratory of laser spectroscopy of solutions of supramolecular compounds and

A project of laser electron X-ray generator for scientific applications I.A. Artyukov, E.G. Bessonov, A.V. Vinogradov, M.V. Gorbunkov, Yu.Ya. ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... It allows viewing collision of electrons with laser photons as the classical Thomson scattering. ... A project of X-ray laser-electron generator [7]. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• http://miles.sinp.msu.ru/files/Instr&Exp_Tech_Engl.pdf

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>12) - asa.guru.ru/ )

• Alexander Antonov's Resume

... Statistical Irreversibility of the Kac Reversible Circular Mo del Valery V. Kozlov* V.A. Steklov Mathematical Institute Russian Academy of Sciences ul. Gubkina 8, Moscow, 119991 Russia Received Octob er 29, 2010; accepted Decemb er 4, 2010 Abstract--The Kac circular model is a discrete dynamical system which has the property of recurrence and reversibility. ... However, this p oint of view contradicts the initial prop erty of reversibility of the equations of motion for mechanical systems. ...

Еще в разделе: (Показать все результаты (>106) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/94a/borisov2011.pdf
• http://ics.org.ru/upload/iblock/c6e/162-coupled-motion-of-a-rigid-body-and-point-vortices-on-a-two-dimensional-spherical-surface_ru.pdf
• http://ics.org.ru/upload/iblock/76b/2524.pdf

... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...

Еще в разделе: (Показать все результаты (>38) - genhis.philol.msu.ru/ )

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>10) - mph.cmc.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• Nhunt: program for nucleic acid sequence similarity search

... For the investigations of the phenomenon leading to non inflation (squidding) of parachute, the influence of canopy permeability and upstream flow on the character of pressure distribution along framework model, imitating round parachute, was studied experimentally. ... The pressure sensors: 13 ones inside and 13 - outside the canopy have been placed for the study of distribution of internal and external pressure on the surface of the model. ... Variant 1. ... Parachute Science] . ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

• Pressure Distribution Peculiariry Along Square Canopy
• A Little History

... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...

Еще в разделе: (Показать все результаты (>11) - www.sciencepark.ru/ )

• MSU Science Park - About us
• MSU Science Park
• MSU Science Park - Projects & Partners

... Геология >> Геохимические науки | Анонсы конференций . ... Международная конференция "Современное состояние наук о Земле" . ... Геологический факультет МГУ . Геологический факультет МГУ им. М.В. ЛомоносоваНаучно-образовательный центр Геологического факультета Приглашаем Вас и Ваших сотрудников принять участие в работе Международной конференции "Современное состояние наук о Земле", посвященную памяти Виктора Ефимовича Хаина - выдающегося . ... И.С. Фомин / Геологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>26) - phys.web.ru/ )

• Все о геологии :: Анонсы конференций - Геохимия ()
• Все о геологии :: Анонсы конференций - Петрология ()
• Все о геологии :: Анонсы конференций - Минералогия ()

To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...

260. Современные тенденции в развитии методов контрацепции