... education . research . ... Fundamentals of Nanotechnology . ... Molecular physiology . ... Pass/fall exam: 5 p.m., 22 May, 2009 (those third-year students who pass the exam undertake further study majoring in Nanosystems and Nanodevices , Functional Nanomaterials , Nanobiomaterials and Nanobiotechnology). ... 10 February 2009 . ... Prof. Yu. ... Work of molecular motors: ATP synthetase, photosynthetic reaction centers, retinal containing photosensitive proteins (rhodopsin, bacteriorhodopsin.) ...
... Atmospheric and Oceanic Boundary Layer Physics V. Lykossov 3.1 Introduction The globe of the earth is surrounded by a gaseous atmosphere which is always in motion. ... One of the most important problems is the parameterization of the turbulent uxes of momentum, latent and sensible heat at the sea surface. ... In the atmospheric surface layer, typically the lower 10 % of the boundary layer, the turbulent uxes of momentum, water vapor and sensible heat are nearly constant with height. ...
... One can compare the positions of these singularities and their corresponding singular variables in the Feynman diagrams which contribute to the signal process under consideration, and to both reducible and irreducible backgrounds. ... For a standard analysis using cuts on variables, one should cut hard against the regions of singularities in the background singular variables while keeping the regions with singularities for the signal singular variables (see e.g. [8]). ...
Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...
Fluctuation in EAS development and estimates of energy and composition of the primary radiation by L. Dedenko, SINP, MSU 1) surface scintillation detectors (SD) 2) detectors of the Vavilov-Cherenkov radiation (VCR) 3) underground detectors of muons (UD) (with the threshold energy ~1 GeV). Yakutsk array Detectors readings · The various particles · of Extensive Air Showers (EAS) · at the observation level · hit detectors · and induce some signals sampled as · detector readings 18.05.2011. IWS. ...
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
... Advanced chapters of operation research . Algebraic characterization of basic solution of linear program. ... Advanced chapters of Actuarial Mathematics . ... Discounted cash flow analysis and capital budgeting as decision tools are given particular emphasis. ... In the first part of the course we present a modern approach to modeling economic systems. ... The problem of tax optimization under a given financing budget. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...
... Electronic journal Issue 4. 10 september 2004 Paliulis N., Chlivickas E. E-government as a Challenge of Public Management Development Introduction. ... This also includes the transfer of various data from hardcopies (documents) to digital media (databases), provision of information and services to citizens and businesses via electronic means (websites, e-mails, etc.) ... The main obstacle for the development of electronic public services is the small number of Internet users in Lithuania. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf -- 226.2 Кб -- 06.07.2014 Похожие документы
... Настройка OpenVPN для ОС семейства Windows описана на веб-сайте службы технической поддержки факультета ВМК . В данном разделе описывается подключение к VPN факультета в ОС GNU/Linux с помощью графического интерфейса, предоставляемого программой KNetworkManager на примере ОС openSUSE 11.2 x86-64. Кликните левой кнопкой мыши по иконке программы KNetworkManager в системном трее и выберете пункт Manage connections : . ... Также нужно выставить галочки ?Use LZO compression? и ?Use TCP connection?: ...
... Настройка OpenVPN для ОС семейства Windows описана на веб-сайте службы технической поддержки факультета ВМК . В данном разделе описывается подключение к VPN факультета в ОС GNU/Linux с помощью графического интерфейса, предоставляемого программой KNetworkManager на примере ОС openSUSE 11.2 x86-64. Кликните левой кнопкой мыши по иконке программы KNetworkManager в системном трее и выберете пункт Manage connections : . ... Также нужно выставить галочки ?Use LZO compression? и ?Use TCP connection?: ...
The Nine Planets is best viewed on-line via a graphical WWW browser which displays the pictures in color and supports hypertext link traversal. ... To view the movies and hear the sounds, you'll need additional helper programs. ... I recommend that you use Netscape as your browser. Netscape can display gif and jpeg images directly without need of any additional helper apps. You do need additional helper apps for movies and sounds, however. ... Yahoo's Helper Applications .. ... Tech Help .. ...
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf -- 1182.2 Кб -- 30.11.2015 Похожие документы
... Методы выделения сигнала из шума при детектировании оптического излучения фотодиодом. ... По мере сужения полосы пропускания такого фильтра [pic] даже при постоянном времени измерения соотношение сигнал/шум будет расти обратно пропорционально [pic] за счет уменьшения мощности тех шумов, которые могут проникнуть на выход системы. ... Отметим, что основной вклад в шумы системы вносит фотодиод и первый каскад усилителя сигналов фотоприемника. ... Измерение отношения сигнал/шум в режиме стробирования. ...
... Вт Мар 31 11:57:41 MSD 2009 . Предыдущее сообщение: PARALLEL.RU - Новости, выпуск #261 [18/03/2009] . ... Детали будут объявлены дополнительно. http ://agora.guru.ru/parallel/ ------------- В издательстве Московского университета выпущена книга: Антонов А.С. Параллельное программирование с использованием технологии OpenMP: Учебное пособие . http :// parallel.ru /info/parallel/openmp/ ------------- ЧТО НОВОГО? http :// parallel.ru /about/whatsnew.html + В рамках совместного Центра МГУ- ...
Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Unit I. Geologic Hazards and Man Unit II. ... Amazing Earth. ... Трансформируйте словосочетания в предложения. 1. geologic processes going on for millions of years 2. any geologic process can become a geologic hazard 3. some geologic hazards having resulted in disaster 4. many geologic hazards have affected the activity of man 5. a lot of earthquakes resulting in landslides 6. some naturally occurring hazards 7. many disasters are caused by geologic hazards 8. some ...
[
Текст
]
Ссылки http://www.geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016 Похожие документы