... 247th American Chemical Society National Meeting and Exposition "Chemistry and materials for energy" , March 16-20, Dallas, TX Talk: A.V. Nemukhin "QM/MM-based modeling of structure and spectra of fluorescent proteins" . ... IV International Symposium "Topical Problems of Biophotonics", July 21-27, Nizhny Novgorod Invited talk: M.G. Khrenova , A.V. Nemukhin, A.P. Savitsky "Molecular modeling of the Forster resonance energy transfer between fluorescent proteins" . ...

Еще в разделе: (Показать все результаты (>4) - lcc.chem.msu.ru/ )

... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>2) - pk.math.msu.ru/ )

. October 999 . Mon . Tue . Wed . Thu . Fri . Sat . Sun . 1 . 2 . 3 . 4 . 5 . 6 . 7 . 8 . 9 . 10 . 11 . 12 . 13 . 14 . 15 . 16 . 17 . 18 . 19 . 20 . 21 . 22 . 23 . 24 . 25 . 26 . 27 . 28 . 29 . 30 . 31 .

Еще в разделе: (Показать все результаты (>4489) - fmp.msu.ru/ )

• http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=10&year=10&catid=35&Itemid=1165
• http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=10&year=100&catid=35&Itemid=1165
• http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=10&year=1000&catid=35&Itemid=1165

... Editorial: Milestones in March on the path to sustainable development Cooperation in the development of deposits in the Arctic Climatic features in Russia 2011 Public Chamber against the expansion of Moscow On the eve of the conference Rio +20 Sochi: the development of green construction Russia 's economic zone in the Arctic Jubilee anniversary of World Water Day Teaching material on climate change Hazards of offshore ... The Arctic shelf is very rich with hydrocarbon resources....

Еще в разделе: (Показать все результаты (>50) - eng.geogr.msu.ru/ )

• http://www.eng.geogr.msu.ru/science/newsletter/1_12.pdf
• http://www.eng.geogr.msu.ru/science/newsletter/12_12.pdf
• http://www.eng.geogr.msu.ru/science/newsletter/10_11_12.pdf

1, 120102 (2012) 2D- - . ... 2D- - E-mail: kozlov@polly.phys.msu.ru 2012 120102-1 [4, 7], . ... 2D- - 1, 120102 (2012) 1D- , x n+1 . ... 5: (), ( ) P () a = 1.9 = 0.1 t = 10000 . ... 2] Kaneko K. Chaos. ... E-mail: kozlov@pol ly.phys.msu.ru In the field of synchronization processes coupled map lattices (CML) represent paradigmatic models of extended systems exhibiting spatiotemporal chaos, self-organization and synchronization due to the rich variety of global qualitative behavior. ... 2012 120102-8 ...

Еще в разделе: (Показать все результаты (>2) - uzmu.phys.msu.ru/ )

... News . About choir . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Bishop Tikhon opened the choir of Moscow State University in Vienna . Choir of Moscow State University spoke at the Vienna branch of the United Nations . ... Posted in: News . Sorry, this entry is only available in Русский . ... Older Entries . ...

Еще в разделе: (Показать все результаты (>2) - new.choir.msu.ru/ )

Introduction to PLASMA ASTROPHYSICS (Selected 10 lectures) Boris V. Somov Astronomical Institute and Faculty of Physics Moscow State University Pushino-na-Oke, 2008 Contents Ab out These Lectures 1 Particles and Fields: Exact Self-Consistent Description 1.1 Liouville's theorem . . . . . . . . . . . . . . . . . . . 1.1.1 Continuity in phase space . . . . . . . . . 1.1.2 The character of particle interactions 1.1.3 The Lorentz force, gravity . . . . . . . . . 1.1.4 Collisional friction . . . . . . . . . . . .

Еще в разделе: (Показать все результаты (>2) - sun.sai.msu.ru/ )

... Nevertheless, in mammals and in other intron-rich organisms, many of the SSs often involve nonconsensus (Nc), rather than consensus (Cn), nucleotides, and beyond the two critical nucleotides, the SSs are not perfectly conserved between species. ... GBE exon intron exon intron exon Acceptor splice site Consensus Nonconsensus -24-23-22 -21-20-19-18-17-16 -15-14-13-12 -11-10 -9 -8 -7 -6 -5 -4 -3 -2 -1 +1 Position number -3 -2 Donor splice site -1 +1 +2 +3 Position number +4 +5 +6 FIG.1.- ...

Еще в разделе: (Показать все результаты (>8) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom_2013.pdf
• http://storage.bioinf.fbb.msu.ru/~roman/insilicobiol_2003.pdf

CLINICAL MICROBIOLOGY REVIEWS, July 2004, p. 581­611 0893-8512/04/$08.00 0 DOI: 10.1128/CMR.17.3.581­611.2004 Copyright © 2004, American Society for Microbiology. All Rights Reserved. Vol. 17, No. 3 Phase and Antigenic Variation in Bacteria Department of Microbiology, School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104-60761 and Department of Medical Microbiology and Immunology, College of Medicine, Texas A & M University System Health Science Center, College Station, Texas

Еще в разделе: (Показать все результаты (>9) - dis.bio.msu.ru/ )

• http://dis.bio.msu.ru/States/Fursova_Mil'ko_2006_en.pdf

... Laboratory of Problems for Magnetism, . ... Study of the magnetic and transport properties of R-3d intermetallic compounds with a magnetic instability of the itinerant-electron subsystem. ... const at high temperatures (Curie-Weiss law) [A.S. Markosyan, Y. Hosokoshi, K. Inoue, Phys. Lett. ... Gaidukova, Y. Hosokoshi, K. Inoue, A.S. Markosyan , Magnetic phase diagram and pressure effect on the magnetic properties of the Y 1? x Gd x Mn 2 intermetallic compounds, J. Phys.: Condens. ...

Еще в разделе: (Показать все результаты (>10) - ferro.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• ConClus

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>2) - arctic.ss.msu.ru/ )

... TELLING AMERICA'S STORY: NARRATIVE FORM AND THE REAGAN PRESIDENCY WILLIA M E LEWI S By 1980 , Americ a ha d los t its sense of direction . ... The n Ronal d Reaga n cam e ont o th e scene wit h a visio n of America that reinvigorate d th e nation . ... NARRATIV E FOR M I N REAGAN' S RHETORI C Reaga n tells tw o kind s of stories tha t differ in scale an d purpose , but that wor k togethe r to establish th e dominanc e of narrativ e form in th e creation and in th e interpretatio n of his rhetoric . ...