МГУ имени М.В.Ломоносова Русская версия . ... Science calendar . ... About Conference . ... Asian and African Studies . ... Art Criticism and History . ... Section Mathematics and mechanics . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... In April 2016 Lomonosov Moscow State University will hold the XXIII Lomonosov International Conference for Students and Young Scientists within the International scientific youth forum "Lomonosov-2016". ...
International Laser Center of MSU . ... Education . ... Laser Graduate School . ... Home Education Continuing Education and Retraining Program . The International Laser Center of Moscow State University accepts visiting scholars from all over the world for training programs in laser physics and technologies. The ILC offers the following continuing education and retraining programs in these fields: . ... International Retraining and Post-docs Program; . Laser Graduate School short courses . ...
The Department of Talented Youth Affairs and Professional Orientation . ... Results of the 48th Mendeleev International Olympiad in Chemistry . ... Lomonosov Moscow State University students have traditionally been active participants of the international Olympiad ?IT-Planet 2013/14? which covers the area of information technologies. ... His next challenge is to defend the honor of the University in the international final which will take place in Crimea in September. ...
... Subject to the MOIP Charter both natural and legal persons may become the members of the Society upon paying admission fees and acknowledging the Charter and program documents. ... Persons may be elected as the Society?s full and corresponding members on a show of hands at the Society?s Council (Presidium) meeting if nominated by a section and recommended by at least two full Society?s members. ... The Society?s full members have the following rights: . ... 2015 Moscow Society of Naturalists . ...
... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...
HBT 10 .. 2015 - ALICE LHC- QGP, QGP 1 fm/c 5 fm/c 10 fm/c 50 fm/c " " - . ... Rout / Rside ~ sensitive to emission duration. ... Rout/Rside 1 ALICE - Phys.Lett.B696:328-337,2011 Heavy Ions STAR and ALICE, 200 and 2760 GeV · All the expected trends are observed: Overall increase of the radii as compared to RHIC Strong dependence of the radii on kT Rout/Rside ratio even smaller than the one at RHIC 04/11/2011 P. Boek,Phys.Rev. C83 (2011) 044910 3D relativistic viscous hydrodynamics. ...
[
Текст
]
Ссылки http://lav01.sinp.msu.ru/~vlk/LECT_2015_new/lect_10_2015_HBT-corr.pdf -- 1567.7 Кб -- 31.03.2015 Похожие документы
... Новости События Объявления Информация Публикации Архив документов Научная деятельность . ... Об издательской деятельности Каталог книг Вестник Московского университета Авторам Содержание выпусков Электронный журнал Проектная деятельность . ... Public administration reform . ... Slatinov V.B. Intermediate-Stage Results of Public Administration Reform: From Chaos in Institutional Structures to Public Management . Leksin I.V. Transformation of the Federal Public Administration Sуstem in 1992 2006 . ...
... MARINE BIOLOGY Features of the Spatial Distribution of Phytoplankton in Nhatrang Bay of the South China Sea during the Rainy Season L. V. Ilyash and D. N. Matorin Biological Faculty, Moscow State University, Moscow, Russia e-mail: ilyashl@mail.ru Received December 20, 2006; in final form, May 15, 2007 Abstract--The species composition, phytoplankton abundance, and relative yield of the variable fluorescence (Fv /Fm) were determined in the mesotrophic Nhatrang Bay in OctoberNovember of 2004. ...
О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ћСписок статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...
... In the literature it is often referred to as electron momentum spectroscopy (EMS) (see Refs. [2, 3] and references therein). ... 2.0 LP, N = 0, Ion : ground RHF , field-free SPM , field-free BK, field-free RHF SPM BK 2.0 LP, N = 0, Ion : ground RHF , field-free SPM , field-free BK, field-free RHF SPM BK ] a.u . [ 3 TDCS x 10 1.0 TDCS x 10 3 0.5 0.0 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 [ 1.0 0.5 0.0 0.0 p F(t) 0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 F(t) 8.0 q [ ...
Gamma-quanta from SNRs V.N.Zirakashvili Pushkov Institute of Terrestrial Magnetism, Ionosphere and Radiowave Propagation, Russian Academy of Sciences (IZMIRAN), 142190 Troitsk, Moscow Region, Russia Outline · Acceleration of particles at forward and reverse shocks in SNRs · Amplification of magnetic fields · Modeling of broad-band emission · Radioactivity and electron acceleration Diffusive Shock ... 2010) . ... Cosmic ray positrons can be accelerated at reverse shocks of SNRs. ...
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...
... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...
. If you see this page, the nginx web server is successfully installed and working. Further configuration is required. For online documentation and support please refer to nginx.org . Commercial support is available at nginx.com . Thank you for using nginx.
... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...
... , Moscow, 119992 Russia Received November 3, 2006; in final form, November 21, 2007 Abstract--Further developing the method for direct multiparticle modeling of electron transport in the thylakoid membrane , here we examine the influence of the shape of the reaction volume on the kinetics of the interaction of the mobile carrier with the membrane complex ... Fig. ... We have previously outlined a direct multiparticle model of electron transport processes in the thylakoid membrane [21, 22...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...