Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
... Custom Query . ... Component . ... automata io requirements ui . ... And љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . Or љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . ... Summary Component Milestone Status Owner Type Priority Resolution Created Modified Blocked By Blocking Reporter Keywords Cc . ...
setup-gsi: Configuring GSI security Installing /etc/grid-security/certificates//grid-security.conf.42864e48.. Running grid-security-config.. G S I : C O N F I G U R A T I O N P R O C E D U R E Before you use the Grid Security Infrastructure, you should first define the DN (distinguished name) that should be used for your organization's X509 certificates. ... Installing Globus CA signing policy into trusted CA certificate directory... setup-gsi: Complete ...
... Effective Presentations . ... Read the following abstract and summarize the main points . ... And on a personal level, the ability to move the audience can shape the trajectory of a manager's career. ... You may open the presentation with a joke to get the audience's attention. Even if you write out your entire speech beforehand, you'll undoubtedly work to sound informal and conversational, possibly posing a few questions directly to the audience throughout the talk. ... Subject / title of talk. ...
... 2 1 2 (2008) 59 available at www.sciencedirect.com journal homepage: www.elsevier.com/locate/ecolmodel The impact of different density stresses on the dynamics of two competitive populations Anatoly T. Teriokhin , Elena V. Budilova Department of Biology, Moscow Lomonosov State University, Moscow 119992, Russia article Article history: info abstract We compare the asymptotic dynamics of two competitive populations described by a ... Second, only the density of youngs can be reduced. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2008_R0r_EcolMod.pdf -- 382.8 Кб -- 16.03.2009 Похожие документы
An electronic file with the submitted manuscript should be of the following form. %---------------------------- \def\udk{UDC} \ltitle{Title of the manuscript (in CAPITAL LETTERS)} {Author initials and name(s)} \oabstract{ Abstract of the manuscript } Text of the manuscript \end{document} %-------------------------- . ... Sectioning of a manuscript without the use of standard commands can be done as follows: %------------------------------------------------ \par {\bf Title of the section.} ...
... wLake 1.7 . wLake is a tool which allows to identify clusters of a structural water molecules in given superimposed 3D structures. Put your coordinates in PDB format into the text area. Select a distance threshold. Two water molecules from different structures will be concidered as located in the same space point if the distance between centers of oxygen atoms is less than this threshold. ... EACH STRUCTURE INCLUDING ITS WATER MOLECULES MUST BE PRESENTED AS SEPARATE MODEL: EXAMPLE. ...
... O ur international collaboration traces back to early 1990's when it became possible in Russia to maintain the links directly between Eastern and Western scientific groups. ... Professor Ole Keller and Professor Kjeld Pedersen from Institute of Physics of Aalborg University, Aalborg, Denmark. ... Professor Mike Downer from Department of Physics, The University of Texas at Austin, Austin, Texas, USA. ... Dr. J. Hlinka from Institute of Physics, Czech Academy of Science, Prague, Czech Republic. ...
... 2009 тАФ Ph.D. in General History (Institute of General History, Russian Academy of Science, Moscow) . ... The mid-French Literary Text: Transition from Manuscript to Incunabula Form and its XV-century Readers. 1995 тАФ MS in the History of Medieval France (Moscow State University, History Department ) . ... Training course in anthropology and cultural studies . ... Central State Museum of the Cinema, Moscow (2009 тАФ to date) . ... State University for Human Sciences, Moscow (2008 тАФ to date) . ...
... The "Mulliken" AMMs up to the fourth order were calculated within the scheme developed by Saunders et al. [13] using the B3LYP, Perdew-Wang (PW91), and Perdew-BurkeErnzerhof (PBE) functionals with the 6-21G** basis set (for shortness, noted below basis set 3 or BS3) for all ALPOs, while the ATN and ATO structures were also considered at other levels as STO-3G (BS1), 3-21G (BS2), and 8-511G*(Al)/8-521G*(P)/8411G*(O) (BS4) for comparison. ... No EP convergence with the basis set was observed. ...
Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...
Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... BDRG . ... DEPRON . ELFIN-L . ... The satellite ?Mikhailo Lomonosov? is based on the platform of the spacecraft ?Kanopus-B? developed by the All-Russia reasearch and development institute of electromechanics named after Iosiphyan (VNIIEM). ... Scientific equipment will weight about 120 kg, while the total weight of the satellite will be about 450 kg. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... UHECR SINP MSU . ... TUS . ... mini-EUSO (UV atmosphere) . News . UHECR news . TLE news . Lab's news . Publications . Publications UHECR . ... For students . Our students . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . JEM-EUSO Extreme Universe Space Observatory on the Japanese Experiment Module (JEM) of the International Space Station . ... JEM-EUSO is a new type of observatory that uses the earth's atmosphere as a detector. ...
479 (2012) 183-185 Contents lists available at SciVerse ScienceDirect Physica C journal h omepage: www.else vier.com/locate/physc Near-field optical microscopy of plasmonic effects in anisotropic metamaterials M.R. Shcherbakov a,, B.B. Tsema a b c a,b , Yu.B. Tsema a, A.A. Ezhov a, V.I. Panov a, D.P Absolute measurements of near-field linear dichroism are performed for an array of plasmonic nanowires by measuring the linear dichroism value at the edge of the sample. ... 1о? aei/ ?b0 sin h ? ...
[
Текст
]
Ссылки http://nanolab.phys.msu.ru/sites/default/files/physc479_183_2012.pdf -- 257.5 Кб -- 16.05.2013 Похожие документы
Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...
SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...
... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...
[
Текст
]
Ссылки http://www.protein.bio.msu.ru/~akula/Kulaichev%20Addition.pdf -- 75.3 Кб -- 29.10.2013 Похожие документы
... Микс 193 A 131 A 171 A 211 A 304 A Корона Магнитограмма . 211 + 193 + 171 . Description . ... LASCO (Large Angle and Spectrometric Coronagraph)- инструмент на космическом аппарате SOHO, поставляющий изображения солнечной короны, на которых свет, идущий непосредственно от Солнца, заблокирован с помощью искусственного затмения, создаваемого самим аппаратом. ... The form and the location of the magnetospheric boundary are defined by pressure balance of the solar wind and geomagnetic field. ...
... About CIE MSU . ... Vestnik CIE (in Russian) . ... About Moscow University . ... The CIE provides tuition in Russian in accordance with the course of study and study programmes depending on the chosen subjects, goals, and forms of study as stated in the student s contract. ... Also the students can use the library, audio collections, video- and computer classes of the Center. ... Students are expected to attend classes, complete academic assignments, observe the University rules and regulations. ...