pic] INTERNATIONAL CONFERENCE HYDRODYNAMIC INSTABILITY AND TURBULENCE March 1-7, 2010 , Moscow , Russia [pic] ORGANIZED by Moscow State University Institute of Mechanics of MSU Dept. of Mechanics and Mathematics of MSU CHAIRMAN Academician G.G. Chernyi SPONSORED by Russian Foundation of Basic Research Moscow State University Institute of Mechanics of ... These conferences were widely attended by scientists and students from Russia and other countries. ...

Еще в разделе: (Показать все результаты (>28) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/Template.doc
• http://hit-conf.imec.msu.ru/books/NeZaTeGiUs_2010.pdf

Optical imaging of fluorescent carbon biomarkers using artificial neural networks Tatiana A. Dolenko Sergey A. Burikov Alexey M. Vervald Igor I. Vlasov Sergey A. Dolenko Kirill A. Laptinskiy Jessica M. Rosenholm Olga A. Shenderova Downloaded From: http://biomedicaloptics.spiedigitallibrary.org/ on 12/17/ 2014 Terms of Use: http://spiedl.org/terms Journal of Biomedical Optics 19(11), 117007 (November 2014 ) Optical imaging of fluorescent ... Results of Using Artificial Neural Networks Fig. ...

Еще в разделе: (Показать все результаты (>28) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/en/articles/2014/Nanosystems_CD_ANN_2014.pdf
• Laboratory of laser spectroscopy of solutions of supramolecular compounds and
• Лаборатория лазерной спектроскопии растворов супрамолекулярных соединений и

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... New approaches to the synthesis of hybrid materials InP - organic stabilizer . ... To replace the membranes using standard samples CT InP, myristic acid, stabilized, and samples heterostructures InP / ZnSe with two monolayers Accrued zinc selenide and also stabilized myristic acid. ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>23) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out

... Stanley Milgram SIX DEGREES OF SEPARATION OR SMALL WORLD PHENOMENON 1998, Small world networks Steven Strogatz Duncan Watts Laszlo Barabasi and Reka Albert 1999 In 1999 American physicits Barabasi and Albert have shown that distribution of nodes by the number of links in tke most real networks is described by power law and they called such networks as scale-free networks Reprinted from Linked: The New Science of Networks by Albert-Laszlo ... Human disease network. ... disease ­ , ). ...

Еще в разделе: (Показать все результаты (>5) - www.soc-phys.chem.msu.ru/ )

... Unemployment of graduates combined with a shortage of highly educated young people is putting the European governments under pressure to act. ... The Bologna Declaration explicitly mentions the lack of competitiveness of European Higher Education institutions. The signatory countries actually explicitly express their goal to "ensure that the European higher education system acquires a world- wide degree of attractiveness equal to [Europe's] extraordinary cultural and scientific traditions". ...

Еще в разделе: (Показать все результаты (>3) - www.edst.msu.ru/ )

... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>17) - pk.math.msu.ru/ )

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

• Air-Permeability Influence on Pressure Distribution Character
• Pressure Distribution Peculiariry Along Square Canopy
• A Little History

Cosmic Research, Vol. 42, No. 5, 2004, pp. 489­534. Translated from Kosmicheskie Issledovaniya, Vol. 42, No. 5, 2004, pp. 509­554. Original Russian Text Copyright © 2004 by Panasyuk, Kuznetsov, Lazutin, Avdyushi, Alexeev, Ammosov, Antonova, Baishev, Belenkaya, Beletsky, Belov, Benghin, Bobrovnikov, Bondarenko, Boyarchuk, Veselovsky, Vyushkova, Gavrilieva, Gaidash, Ginzburg, Denisov, Dmitriev, Zherebtsov, Zeleny, Ivanov-Kholodny, Kalegaev, Kanonidi, Kleimenova, Kozyreva, Kolomiitsev, Krasheninnikov,

Еще в разделе: (Показать все результаты (>2) - solarwind.cosmos.ru/ )

• http://www.kosmofizika.ru/buri/vesel2.pdf

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Вакансии . ... Информация о компании: Procter . ... BECOME A SUPPLY CHAIN LEADER! The mission of the Supply Network Operations team in P&G is to transform consumer demand into a supply plan and deliver the products to the shelves so that right P&G products are at the right place at the right time - and at the right cost and are available to P&G Consumers. ... Qualifications to succeed in Supply Network Operations: . ...

Еще в разделе: (Показать все результаты (>102) - www.physcareer.ru/ )

• Receptionist (Секретарь на ресепшн) / Вакансии / Physcareer.ru
• Key Account Manager Financial Institution and Alternative Distribution (Code -
• Quantitative Developer / Вакансии / Physcareer.ru

... On-line консультант . ... Приглашаем всех, интересующихся исследованиями и разработками в области компьютерных сетей, принять участие в семинаре по software-defined networking, который состоится 4 июля 2011 (понедельник) в 19.30 в Политехническом музее (Новая площадь, д 34;, подъезд 9, малая аудитория). ... We are about to witness a revolution in the networking towards so-called "Software Defined Networking" (SDN). SDN enables innovation in all kinds of networks . ... Copyright ВМиК МГУ , 2008 . ...

Еще в разделе: (Показать все результаты (>10) - erp.cmc.msu.ru/ )

Nonlinear Dyn DOI 10.1007/s11071-014-1811-5 ORIGIN AL PA PER On the loss of contact of the Euler disk Alexey V. Borisov · Ivan S. Mamaev · Yury L. Karavaev Received: 25 October 2013 / Accepted: 13 November 2014 © Springer Science+Business Media Dordrecht 2014 Abstract This paper is an experimental investigation of a round uniform disk rolling on a horizontal surface. ... It is seen from Table 2 that the larger the mass of Euler's disk, the shorter the loss of contact with the surface before the stop. ...

Еще в разделе: (Показать все результаты (>116) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/336/170-statistical-irreversibility-of-the-kac-reversible-circular-model_en.pdf
• http://ics.org.ru/upload/iblock/7d3/154-lagrange-s-identity-and-its-generalizations_en.pdf
• http://ics.org.ru/upload/iblock/94a/borisov2011.pdf

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>6) - biophys.msu.ru/ )

• CURRICULUM VITAE

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>5) - mph.cmc.msu.ru/ )

... Correlative immunostaining with anti-tubulin antibodies and electron microscopy established that apparent free microtubules observed in vivo were not growing ends of long stable microtubules. ... A) Plus and minus ends of free MTs; (B) ends of long MTs. ... Minus ends of free MTs in PtK1 cells are stable The production of free minus ends of MTs in PtK1 cells has now been observed by three pathways: self-assembly in the cytoplasm, release from the centrosome (Keating et al., 1997) and breakage of MTs...

Еще в разделе: (Показать все результаты (>35) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/neverova99.pdf
• http://cellmotility.genebee.msu.ru/html/articles/alieva94.pdf
• http://cellmotility.genebee.msu.ru/html/articles/jcs99.pdf