Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...
. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China
Moscow Astronomical Plate Archives: . Contents, Digitization, Current and Possible Applications . ... We describe the astronomical plate archives in Moscow and Zvenigorod and the existing digitization projects. ... 2 The Plate Archive of the Sternberg Institute . The contents of the most important Moscow astronomical plate archive, that of the Sternberg Astronomical Institute, was briefly presented in Shugarov et al. [1] in 1999. ... THE MOSCOW PLATE COLLECTION (STERNBERG INSTITUTE) . ...
. This presentation contains content that your browser may not be able to show properly. This presentation was optimized for more recent versions of Microsoft Internet Explorer. If you would like to proceed anyway, click here .
... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...
... Catalog . ... This web application is brought to you by the following people (in alphabetical order): . Alexey Sergeev, markup issues . Artemy Tregoubenko , JavaScript code . Elena Glushkova, content management . ... We would like to acknowledge the usage of these open source technologies: . Django , web framework . PostgreSQL , database management system . ... SAMP-Webtools , set of JavaScript tools for SAMP-enabled web applications . Developed by the Team . ...
Официальный сайт эксперимента . ... Эксперимент СФЕРА . ... ШАЛ . ... Уникальный метод, используемый в эксперименте СФЕРА, является развитием идеи советского академика Александра Евгеньевича Чудакова и ранее в мировой практике не использовался. ... Изображение пятна черенковского света и трека ШАЛ проецируется на мозаику фотоумножителей с помощью сферического зеркала. ... Институт ядерных исследований РАН . ... Эксперимент СФЕРА SPHERE еxperiment . ...
Uneex . SeminarZope2 . ... Структура CMF, как выглядит сайт "изнутри". ... Объекты CMF . ... Надстройки над CMF . Plone . FCM . Silva . ... CMF: http://cmf.zope.org/ . ... Plone: http://www.plone.org/ . FCM: http://freehand.ru/Products/FCM . Silva: http://www.infrae.com/products/silva . Copyright 2003 by the contributing authors. All material on this site is the property of the contributing authors. Send feedback to svv at cmc dot msu dot ru. ...
ПУБЛИКАЦИИ СОТРУДНИКОВ . КАФЕДРЫ ХИМИЧЕСКОЙ ЭНЗИМОЛОГИИ . в 1990-99 г.г. ВНИМАНИЕ!! ... Для составления более полного списка просим сотрудников кафедры предоставить недостающие публикации в виде файла, используя формат, по которому представлены ссылки. Файлы можно присылать по электронной почте по следующим адресам: vit@enz.chem.msu.ru или lad@enz.chem.msu.ru . ГОД . Количество публикаций . 1999 . ... 1990 . ... 1998-2000 Кафедра Химической Энзимологии, Химический Факультет . ...
. This presentation contains content that your browser may not be able to show properly. This presentation was optimized for more recent versions of Microsoft Internet Explorer. If you would like to proceed anyway, click here .
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...
... Полезные материалы . Ответственные за содействие трудоустройству на факультетах МГУ . Статистика по трудоустройству выпускников . Службы по трудоустройству на факультетах МГУ . Полезные ссылки по поиску работы для студентов и выпускников . Ассоциации и клубы выпускников МГУ . ... Вы находитесь на сайте Центра трудоустройства и работы с выпускниками МГУ имени М.В.Ломоносова. ... Центр трудоустройства и работы с выпускниками МГУ имени М.В.Ломоносова. ...
... Центральный узел Системы ДО МГУ. ... Применение SCORM 2004 Content Aggregation Model при создании базы данных системы дистанционного обучения ФДО МГУ. Информационная среда дистанционного обучения (ИСДО) ФДО МГУ предназначена для обеспечения коммуникационной и информационной поддержки процесса дистанционного обучения . ... В настоящее время предложено несколько стандартов электронного дистанционного образования. В настоящее время база данных ИСДО ФДО МГУ содержит более 100 таблиц . ...
... This study examined the role of plasma lipids in the regulation of erythrocyte membrane viscosity, oxy-Hb content as well as Na+/H+ exchange and Ca2+-ATPase, whose activities are altered in patients with CVD. Both oxy-Hb content and erythrocyte membrane fluidity were decreased in essential hypertension and coronary artery disease patients and negatively correlated with plasma cholesterol but not triglyceride content. ...
... MATHEMATICAL AND SYSTEM BIOLOGY UDC 577.1 Membrane Profile-Based Probabilistic Method for Predicting Transmembrane Segments via Multiple Protein Sequence Alignment R. A. Sutormina and A. A. Mironova a b , b, c State Research Center GosNIIgenetika, Moscow, 117545 Russia; e-mail: sutor_ra@mail ... Bioinformatics, Moscow State University, Moscow, 119992 Russia Received January 25, 2006 Abstract--Prediction of transmembrane (TM) segments of amino ... Protein Sci. ... Proteins. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/mol_biol_mosk_2006.pdf -- 151.6 Кб -- 25.05.2006 Похожие документы
Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... Mathematical Reviews MR2056325 . What makes this new book an outstanding contribution to stability theory? First of all, the book succeeds in bringing qualitative results of the famous Russian school of applied mathematics to stability theory, making these results quantitative and applicable. ... Reviewed by Professor Wolfhard Kliem . ...