ВЛИЯНИЕ ЖИДКИХ СРЕД И ТЕМПЕРАТУРЫ НА РЕЛАКСАЦИЮ НАПРЯЖЕНИЙ В ПОЛИМЕРЕ О.В. Андрющенко, Т.М. Джунисбеков, И.М. Керштейн Таразский государственный университет им. М.Х. Дулати ola-a@tarazinfo.kz, oric@mail.ru, kershtein@imec.msu.ru РЕЗЮМЕ В работе на основе положения термофлуктуационного разрушения и представления полимера в виде элемента Регеля получены определяющие соотношения для определения релаксации напряжений в полимере при воздействии на него жидкой среды и при изменении температуры. ...

Еще в разделе: (Показать все результаты (>9) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/CD/SalnikovaA.pdf
• http://hit-conf.imec.msu.ru/2012/abstracts/AbbasovSukhinov.doc
• http://hit-conf.imec.msu.ru/2006/CD/SalnikovaA.doc

AE008878 AE006468 |AE008878| ... Length = 22418 Score = 2861 bits (1443), Expect = 0.0 Identities = 2172/2415 (89%) Strand = Plus / Minus Query: 1 atgtcgaattcttatgactcctccagtatcaaagtcctgaaagggctggatgcggtgcgt 60 || Sbjct: 21203 atgtcgaattcttatgactcctccagtatcaaagtcctgaaagggctggatgcggtgcgt 21144 Query: 61 aagcgcccgggtatgtatatcggcgacacggatgacggcaccggtctgcaccacatggta 120 || ... Sbjct: 18863 atgggtgatgccgttgagccgcgtcgtgcctttatcgaggagaacgccctgaaagcagcg 18804 Query: 2401 aatatcgatatttaa 2415 || ...

Еще в разделе: (Показать все результаты (>14) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/results.txt

... Abstract A. V. Dmitriev, A. V. Ivanov, A. R. Khokhlov, Numerical simulation of light propagation through a diffuser, Fundamentalnaya i prikladnaya matematika, vol. 15 (2009), no. 6, pp. ... In this article, the light propagation in a diffuser with optically soft inclusions is described with the help of the Fokker--Planck equation, i.e., a transfer equation with a diffusion term in the space of radiation propagation directions. ... 8, 9] , x1 , : 1 D = (3 - x1 ), 6 3 x1 = 2 d x( )cos sin . ...

Еще в разделе: (Показать все результаты (>2) - lizard.phys.msu.su/ )

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... Mathematical Reviews MR2056325 . What makes this new book an outstanding contribution to stability theory? First of all, the book succeeds in bringing qualitative results of the famous Russian school of applied mathematics to stability theory, making these results quantitative and applicable. ... Reviewed by Professor Wolfhard Kliem . ...

Еще в разделе: (Показать все результаты (>10) - mailybaev.imec.msu.ru/ )

... Master . Master net Homepage . ... About Space Monitoring Laboratory, scientific directions, instruments, contacts . ... 18.06.2013 . ... J142023.5-485540. ... MASTER OT J142023.5-485540 относится к редкому подклассу . ... Астронома ATel #5144: http://www.astronomerstelegram.org/?read=5144 . ... The brightest MASTER's dwarf nova discovered in Argentina! ... astronomical object - dwarf nova MASTER OT J142023.5-485540 in Lupus . ... record (12.6m) belonged to the dwarf nova in Perseus MASTER . ...

Еще в разделе: (Показать все результаты (>3) - master.sai.msu.ru/ )

... Manuscript Submission . Publication Procedure . ... After the refereeing process is complete, the manuscripts may be declined or returned to the authors for revisions, or accepted for publication. ... The best way to learn how to format the manuscript is to look at several papers already published in the journal. ... Moscow: Moscow University Press, 1969. ... The manuscript of the manuscript> is submitted for publication in the on-line journal "Vychislitel’nye Metody i Programmirovanie". ...

Еще в разделе: (Показать все результаты (>10) - num-meth.srcc.msu.ru/ )

... 0.2 100/ [1,2]. ... 1:10, 1:100, 1:1000 , . ... T= t2 ( 1 - r) 2 + 4 r sin2 ( ) r (1) t r , , =4d/, d - - . ... F, max. ... y- x y , E. x- Ex Ey a x-y [6,8]: E 2 + E 2 - 2 E E cos( - ) = a 2 sin2 ( - ) x y xy x y x y ( 5) (5) , x-y Ex=(-1)mEy x-y =m (m=0, ±1, ± 2, .. ... cos , sin . ... Imax/Imin . ... n, n - (). - ( ), , 1, , d = 2N 9 ( 9) , d, n. 1, , : = T max = ( 1 + R ) 2 T 1- R min ( 10 ) ( r) 1 / 2 d F= = 1- r d ( 11 ) Imax Imin , , d , d - , R "", . ... d d=0.1 X, X - . ... 1970. ...

Еще в разделе: (Показать все результаты (>2) - photonics.phys.msu.ru/ )

• Физика микроволн - Кафедра фотоники и физики микроволн МГУ

19 181 JJ- .. 19 « JJ-» 181 - « » 2015 539.1 22.3873 70 : .. ... J-J- J1 D1 , D2 . J > 1,022 ( ) , ­ . ... NaI(Tl)) (HpGe Ge(Li)) , . ... 10 , 128в128 ( X Y ­ , Z ­ ). ... 11 Z19_Uran Z19_Analyze ( , Z19_Uran), « 2». ... NaI(Tl) ( Z19_Uran). 3) (Z19_Uran): ) J- 181, , : EJ 1 = 133,02 , EJ 2 = 136,25 , EJ 3 = 345,8 , EJ 4 = 482 , EJ 5 = 615 ( ­ ); , ; ) . ... 2 ) ; , , , (Z19_Uran); ) X Y, ( Z19_ Analyze); ) , J-J-; ) (. ... Z19_Analyze 19 «J-J » Z19_Analyze , Z19_Uran. - (). , , . ...

Еще в разделе: (Показать все результаты (>2) - prac-gw.sinp.msu.ru/ )

... if (B1) { S1; } if (B1) { S1; } if (B2) { S2; } - - ...exp... int x = 1; if (x == 1) { std::cout << "Okay" << std::endl; } else { std::cout << "Error" << std::endl; } -- ­ int strlen(const char* p) { int len = 0; do { ++len; } while (*p++); return len; } «», «bbb» -- , : · ­ , , · ­ , , · ­ , · ­ . ... 1977 ­ LTL, · , 1981 ­ (CTL), · , , 1981 , , 1982 ­ model checking ( ), · , 1986 ­ model checking ( ), · , 1989 ­ SPIN. ... The Spin Model Checker: Primer and Reference Manual, Addison Wesley, 2003. ...

250. Заседание 74

251. Gleb V. Belov Laboratory of Chemical Thermodynamics

252. Новая учетная запись