... Academic Programmes . ... Vestnik CIE (in Russian) . FAQs (in Russian) . ... About Moscow University . Links (in russian) . ... Test Your Russian ? ... Lomonosov Moscow State University . ... Day- -Month- -Year- . ... Choose- Male Female . ... Choose- -Other- . ... Russian language for academic purposes major subjects) . Course: . ... Choose- during academic year summer courses . ... Course dates: . ... Choose- professional training refresher course brief refresher course traineeship . ...

Еще в разделе: (Показать все результаты (>18) - www.cie.ru/ )

• Information about Moscow :: Useful Information :: CIE

... ADSP2181 Data Sheet. ... ********************* ********* * * This sample program is organized into the following sections: * * Assemble time constants * Interrupt vector table * ADSP 2181 intialization * ADSP 1847 Codec intialization * Interrupt service routines ********************************************************* ********* .module/RAM/ABS=0 loopback; {************* ... transmit i? 68 |||! |||! |||+============= control bit ||+-------------|+--------------control bit +---------------- ! ...

Еще в разделе: (Показать все результаты (>3) - lib.sinp.msu.ru/ )

• http://lib.sinp.msu.ru/static/tutorials/52_p1.pdf

... The majority of tested compounds exhibit the predicted anxiolytic effect. ... Chem. ... Biological activities associated with anxiolytic effect in No. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 a b 6561 PAS S A SS Number 1462 390 232 126 131 60 131 24 16 60 20 242 51 986 219 30 147 146 16 5 325 40 88 7 10 58 11 12 209 104 14 42 38 47 79 161 414 41 ... The average number of punished water licks caused by compound 3 was 785. ...

Еще в разделе: (Показать все результаты (>139) - www.chem.msu.ru/ )

• Семинар "Перспективные наноматериалы"
• Конференция выпускников Химфака МГУ, работающих за рубежом
• Scientific conference Women in chemistry: biographical portrait, contribution

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>2) - ocl.sai.msu.ru/ )

... Biological Faculty . Moscow State Lomonosov University . ... EDUCATION : B.S. Lomonosov Moscow State University, 1971 Physics . M.S. Lomonosov Moscow State University, 1972 Biophysics . Ph.D. Lomonosov Moscow State University, 1978 Biophysics . ... Lomonosov Moscow State University, 1990 Biophysics . ... 1972-1978 Research assistant Lomonosov State University, Moscow . ... Mathematical modelling in biology, . ... Lecturer at Biological Faculty, Lomonosov State University, Moscow . ...

Еще в разделе: (Показать все результаты (>8) - biophys.msu.ru/ )

• Stress of plant cells

Lomonosov Moscow State University | pic] |Faculty of Biology | ... Application | ... Name | ... First Name | ... Other Names | ... Date of Birth | ... Place of Birth | ... Passport | ... Passport issued | ... City | ... 2.|e-mail | ... Faculty | ... Russian Consulate to be applied to for visa[1] |10.| City, state | ... The visa invitation supposes your stay in Moscow and a region adjacent to WSBS ONLY. ... 1] Cannot be changed after application ...

Еще в разделе: (Показать все результаты (>3) - www.bio.msu.ru/ )

On the connection between the Wiener-Hopf method an the theory of ordinary differential equations A.V.Shanin September 7, 2000 Abstract The application of the classic Wiener-Hopf method involves the procedure of additive decomposition of a function into two terms, one of which is regular in the upper complex half-plane and another is regular in the lower half-plane. ... We obtain the representation of the seeked functions in quadratures. ... Using the last equation, one can find unknown functions. ...

Еще в разделе: (Показать все результаты (>38) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/lecture/matmodel.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/emen.pdf
• A.V.Shanin

... The Informativeness of Coherence Analysis in EEG Studies A. P. Kulaichev UDC 612.821.6 Translated from Zhurnal Vysshei Nervnoi Deyatel'nosti imeni I. P. Pavlova, Vol. ... KEY WORDS: coherence, spectral analysis, EEG non-stationarity, amplitude modulation. ... In particular, the two fundamental differences between EEG signals and most other physical signals are not considered: a) fundamental non-stationarity; b) amplitude modulation at all frequency ranges. ... Coherence in technical addenda. ...

Еще в разделе: (Показать все результаты (>9) - www.protein.bio.msu.ru/ )

• Statistics, Electra-physiology, Frequency analysis, Automation

... Rod unfortunately was not able to come to Garmisch this year, but has been in touch with the Russian Internet community in Seoul, Sharm el Sheikh, Nairobi, and the United States, and has sent a special letter to Vladislav Petrovich. ... ICANN is working with regional associations and the Internet Society in a global training program that is raising the security awareness and skills of those DNS operators in regions where resources for such training are limited. ...

Еще в разделе: (Показать все результаты (>3) - www.iisi.msu.ru/ )

Cell Biology International 28 (2004) 139­150 Cell Biology International www.elsevier.com/locate/cellbi Vertebrate primary cilia: a sensory part of centrosomal complex in tissue cells, but a "sleeping beauty" in cultured cells? ... Primary cilium in the cell cycle In some cultured cells structure of mature centriole is different from regular one described elsewhere (Vorobjev and Chentsov, 1980, 1982). ... In both cultures we failed to find primary cilium (no cilium for 80 cells in each culture). ...

Еще в разделе: (Показать все результаты (>27) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/jcs.pdf
• http://cellmotility.genebee.msu.ru/html/articles/neverova99.pdf
• http://cellmotility.genebee.msu.ru/html/articles/vorobjev83.pdf

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...