... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

The %INCLUDE{...}% macro embeds the content of the specified topic at the place where the INCLUDE is used. The whole content or only parts of of a page can be included. ... INCLUDE{ "page" pattern="reg-exp" rev="2" warn="off" section="clients" PARAMETER1="value" PARAMETER2="Some value" }% . ... You include the topic with this line %INCLUDE{"MyTopic" BETTER="apples" WORSE="Oranges"}% . ... This topic: System > WebHome > ReferenceManual > UserDocumentationCategory > IncludeTopicsAndWebPages . ...

Еще в разделе: (Показать все результаты (>13527) - wiki.cs.msu.ru/ )

• (backlinks in System Web) WebTopBarExample < System < Foswiki
• (backlinks in System Web) InstallationGuidePart1 < System < Foswiki
• (backlinks in System Web) AdminSkillsAssumptions < System < Foswiki

The Early Music Theatre >> Repertoire >> Carmina Profanae . ... It is based on Karl Orff's cantata "Carmina Burana" and songs of 13th-century vagrants. ... The performance includes all the 25 parts of Orff's cantata "Carmina Burana" in Latin, old-Bavarian, and Russian (translations by M. Gasparov and L. Ginsburg) as well as authentic songs of 12-13th-century vagrants from "Carmina Burana" collection: "In taberna quando sumus", "Ecce gratum", "Tempus est iocundum". ...

Еще в разделе: (Показать все результаты (>5) - www.tsm-msu.ru/ )

• The Early Music Theatre -- The Prophetess (The History of Dioclesian)
• Life of wonderful Mr. Handel

... Electronic journal Issue 4. 10 september 2004 Ulrich M. Sustainable Management of Natural Resources Introduction. ... To learn about the dynamics of natural resource management and the tragedy of the commons by means of a direct experience in the simulation game «NEW COMMONS GAME». ... 2) Tragedy of the commons and management of natural resources. ... The simulation game was followed by a short debriefing on the dynamics of the tragedy of the commons and natural resource management. ...

Еще в разделе: (Показать все результаты (>10) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf

... You represent the Union of Rectors uniting the principals of almost all higher educational institutions of the country, and this association has well-deserved recognition. ... From V. Putin's speech at the meeting with the Russian Union of Rectors, Moscow, August 24, 2011. ... At the X Congress of the Russian Union of Rectors the President of RUR V.A. Sadovnichy suggested the creation of interactive inter-university scientific and educational project "University Department" . ...

Еще в разделе: (Показать все результаты (>46) - www.rsr-online.ru/ )

... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...

Еще в разделе: (Показать все результаты (>10) - polit.msu.ru/ )

• Студенческая жизнь

Козлов А.Н. Кинетика ионизации и рекомбинации в канале плазменного ускорителя. Известия РАН, механика жидкости и газа. 2000, ? ... Kozlov A.N. Modeling of rotating flows in the plasma accelerator channel with longitudinal magnetic field. ... Kozlov A.N. Plasma flow peculiarities in accelerator channel with longitudinal magnetic field. ... Kozlov A.N., Zaborov A.M. Formation of the current attachments in plasma accelerator channel under influence of the longitudinal magnetic field. ...

Еще в разделе: (Показать все результаты (>5) - compmech.math.msu.su/ )

... Dmitry Stepanovich (VIDEO of March 2011) . Olga Silchenko, a soloist of the Early Music Theatre . ... Anna and Olga Silchenko have presented the duets by Rubinstein and Chaikovsky (VIDEO) . ... Two Russian romances - duets by Olga Silchenko and Dmitry Stepanovich (VIDEO) . ... N. Rimsky-Korsakov "The Tsar's Bride", the duet of Lubasha and Gryaznoy - by Olga Silchenko and Dmitry Stepanovich (VIDEO) . ... Vivaldi "Magnificat", 6th part, duet by Anna and Olga Silchenko (VIDEO) . ... Olga Silchenko . ...

Еще в разделе: (Показать все результаты (>50) - sn.sai.msu.ru/ )

... ОПРЕДЕЛЕНИЕ КОНЦЕНТРАЦИИ ОКСИДА УГЛЕРОДА В ВОЗДУХЕ АТМОСФЕРЫ . ... Руководитель работы: учитель экологии Лысенкова Е.В. В воздухе атмосферы промышленных городов наряду с естественными примесями, . ... углерода в воздухе атмосферы в районе школы ? ... Для определения концентрации оксида углерода в атмосферном воздухе был . ... Зарегистрированный в пробах воздуха атмосферы уровень окиси углерода . ... Санкт-Петербург, АО НПП , 1997, 28 с. Definition of carbon oxide concentration in atmosphere air . ...

Еще в разделе: (Показать все результаты (>27) - www.ecocoop.ru/ )

• http://www.ecocoop.ru/eco/archive1/messages/416.html
• The Ecological Cooperation project is the first large scale childrenтАЩs

... Unemployment of graduates combined with a shortage of highly educated young people is putting the European governments under pressure to act. ... The Bologna Declaration explicitly mentions the lack of competitiveness of European Higher Education institutions. The signatory countries actually explicitly express their goal to "ensure that the European higher education system acquires a world- wide degree of attractiveness equal to [Europe's] extraordinary cultural and scientific traditions". ...

Еще в разделе: (Показать все результаты (>2) - www.edst.msu.ru/ )

... взаимодействие языка и культуры в контексте сравнительно-исторических исследований; . ... The Philology Faculty of Moscow State Lomonosov University will hold the VIII International Scientific Conference on Comparative-Historical Linguistics 'Modern methods of comparative historical research', from 25 to 27 September 2013, which is traditionally organized by the Department of General and Comparative-historical linguistics. ... History of Comparative Linguistics. ...

Еще в разделе: (Показать все результаты (>45) - genhis.philol.msu.ru/ )

Антонов А.С. Технологические аспекты адаптации последовательных программ для массивно-параллельных компьютеров // В сборнике "Научная апробация слушателей ВКШ". Изд-во МГУ, 1995. ... С. 32-36. ( http://parallel.srcc.msu.su/about/report.html ) . ... Андреев А.Н., Антонов А.С., Воеводин Вл.В., Жуматий С.А. Профессиональные научные центры в сети Интернет. http://parallel.ru // Технологии информационного общества - Интернет и современное общество: Материалы Всероссийской объединенной конференции. ...

Еще в разделе: (Показать все результаты (>7) - asa.guru.ru/ )

• Alexander Antonov's Resume

... 1.1. ... re = mec 2 re. re=2.82ћ10-13 . ... 299.7925 300 -- : -12 -12 1 = 1.602192ћ10 1.6ћ10 . ... 12 1.602192 10 (/) - -- - () (e-) (e+): e- + e+ . ... 0 (4) : 1/2 (1.2) 4e2 N e 0 = = 5.64 10 me 4 N e ( -3 ) -1. . ... 2.5) E~m 2 eV0 = me e 4 2 = 27.21165 27.2 -- . ... 2.5) me c : (2.6) 2Ry = me c 2 me e4 e4 = 2 2 = 2 10-4. 2 c me c 2 , . ... t=1/, meV 2 t ~ . ... re e 2 mee 2 e4 = 2 = 2 2 = 2. a0 mec 2 c , (2.6). , . ... t0 = a0 V0 = 3 me e 4 2.5 10 -17 , 0 = 1 me e4 = 3 4.11016 c-1 , t0 , . ...

Еще в разделе: (Показать все результаты (>6) - heritage.sai.msu.ru/ )

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:49:59 Wed , 15 Dec 2010 22:35:46 GMT Alex Martynov martiran@тАж [20:37e8bca3ae66] * main.py ( modified ) main.UI.__init__() main.UI.button_pack() Wed , 15 Dec 2010 21:49:08 GMT Alex Martynov martiran@тАж [19:e50ef4c6cc54] * main.py ( modified ) main.UI.__init__(), part Wed , 15 Dec 2010 21:13:53 GMT ...

Еще в разделе: (Показать все результаты (>200) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/snake/log/?format=changelog&rev=e50ef4c6cc54e6f43c59a9347deac04d5147a1e3&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/snake/log/?format=changelog&rev=19%3Ae50ef4c6cc54&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/snake/log/?format=changelog&rev=000c22d7b89c64693a05473dec642be4b1cdf0cf&limit=100&mode=stop_on_copy

... Erjemkin Alexey . ... Rich Reddrop . ... Bobkov Garik . ... 7 .300 . ... Ned Reddrop . ... 0 .666 . Kudrjashov Alexandr . ... 2 .000 . ... 0 .400 . ... Teams . ... MSU . ... Reddrop Rich . ... Bobkov (L 0 - 1) . ... Erjemkin . ... Reddrop Ned . ... Kudrjashov . ...

Еще в разделе: (Показать все результаты (>3) - mguteam.chat.ru/ )

... Most of us spend a good part of our lives working in organizations, either as employees or managers, or both.љ The chief purpose of this courseљљ is to provide you with theoretical insights, practical skills, and ethical standards of the discipline of management with a focus on information management and human resources.љ The course is focused on people in organizations and their interactions.љ ... Администратор : Mira Bergelson . Преподаватель: Mira Bergelson . ...

Еще в разделе: (Показать все результаты (>10565) - moodle.ffl.msu.ru/ )

• Summary of Telecollaboration project_Spring 2013
• Moodle ФИЯР МГУ

... Useful Information . ... Vestnik CIE (in Russian) . ... Information about Russia . ... With an area of 17,075,200 square kilometres, it is the largest country in the world by land mass, covering almost twice the territory of the next-largest country, Canada. ... Formerly the dominant republic of the Union of Soviet Socialist Republics (USSR), Russia is now an independent country and an influential member of the Commonwealth of Independent States, since the Union s dissolution in December 1991. ...

Еще в разделе: (Показать все результаты (>35) - www.cie.ru/ )

• Cultural Programmes and Excursions :: Academic Programmes :: CIE
• Para Ayudar Al Profesor :: CIE
• Teatro :: Vida Estudiantil :: CIE

. РУС / ENG . Division of Applied Mathematics, . Faculty of Physics, MSU . Main Division structure Research work PhD study Graduate Undergraduate Work with students Archive Enter . Work with students . Conferences . Conference "From atom to galaxy" . Training Courses . ї Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016.

259. Index of /~bahmurov/course_realtime/papers/

260. silicon detector laboratory