... Дистанционное обучение . Learning and Teaching with the Web . ... Multimedia Educational Resource for Lerning and Online Teaching . ... Foreign Language Teaching Forum . Center for Enhancement of Teaching and Learning . Resources for Teaching . ... The European Association for Distance Learning . European Distance and e-Learning Network . ...
... Исследователи химического факультета МГУ представили проект моделирования молекулярной динамики опасных вирусов . ... Владимир Пентковский, известный разработчик программно-аппаратных архитектур, заслуженный исследователь Intel, обладает большим опытом создания научных коллективов в России, США и Индии. ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...
... Up: Человек против Бога Previous: 3. ... Человек против Бога . This document was generated using the LaTeX 2 HTML translator Version 96.1 (Feb 5, 1996) Copyright ї 1993, 1994, 1995, 1996, Nikos Drakos , Computer Based Learning Unit, University of Leeds. ... The translation was initiated by Lipunov V.M. on Sat Jan 9 14:41:03 MSK 1999 . Lipunov V.M. Sat Jan 9 14:41:03 MSK 1999 . Copyright (c) "Русский переплет" . ...
... Education: Moscow Institute of Physics-and Techniques (MFTI), 1955 – 1961 . ... Engineer – Physic, MFTI Diploma, 1961 . candidate of physics and mathematics, 1967 . ... Scientific Award: 1992 , Linneaus Medal in Silver, Royal Academy of Sciences of Sweden. ... 1961 – 1967 Engineer, Scientific Researcher . ... Present position: Leading Scientist, Department of Space Physics, Scobeltsyn Institute of Nuclear Physics, Moscow State University . ... ph: +7 095 939 42 90 (office) . ...
... Philosophical Transactions of the Royal Society (Biological Sciences) . ... Biochimica et Biophysica Acta (Elsevier Science) . ... Discrete and Continuous Dynamical Systems, Series B (American Institute of Mathematical Sciences) . ... Physics in Medicine and Biology (Institute of Physics) . ... Mathematical Medicine and Biology: A Journal of the IMA . Mathematical Medicine and Biology will publish original articles with a significant mathematical content addressing topics in medicine and biology. ...
Самсонов В.А., Шамолин М.В. К задаче о движении тела в сопротивляющейся среде // Вестн. ... Шамолин М.В. Определение относительной грубости и двупараметрическое семейство фазовых портретов в динамике твердого тела // Успехи матем. наук. ... Шамолин М.В. Случаи интегрируемости уравнений движения четырехмерного твердого тела в неконсервативном поле сил // 'Современные проблемы математики, механики и их приложений'. ... Шамолин М.В. Движение твердого тела в сопротивляющейся среде // Матем. моделирование. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Faculty of Soil Science, Moscow State University . ... Evaluation of acid deposition effects on soils as a component of forest ecosystems. ... Estimation and prediction of forest soil response to acid deposition with simple process-based models. ... Forest soil response to acid deposition, in particular the significance of soil organic matter in the processes of proton consumption, sulphur retention, aluminium and heavy metals mobilisation was investigated. ... Acid Deposition and Forest Soils. ...
Лекции Dr. Sheldon Landsberger, профессор университета Техаса USA. Дубна, 14.04.2014 . Информируем Вас и приглашаем посетить лекции Dr. Sheldon Landsberger, . Professor in the Nuclear and Radiation Engineering Program in the Mechanical Engineering Department at the University of Texas at Austin, USA . ... Applications in Environmental Analysis Лекции будут проходить в конференц-зале ЛНФ в следующие дни: . ... Аннотация в приложении: hep.msu.dubna.ru/main/file.php/74/Landsberger.zip . ...
... Объединенная геофизическая практика студентов кафедры физики Земли и кафедры физики атмосферы на Камчатке - лето 2015 года . ... Стараниями секретаря физико-математического факультета, а затем и помощника ректора Московского университета профессора Э. Е. Лейста в 1906 году на факультете была организована специальность физической географии и метеорологии, а кафедра физики преобразована в кафедру физики и физической географии. ... Заведующий кафедрой физики Земли академик В. А. Магницкий (1915-2005) ....
... 203 When was Ptolemy's Star Catalogue in 'Almagest' Compiled in Reality? ... The initial data are star coordinates contained in the star catalogue. ... They lead to additional errors, and eliminating them provides additional accuracy. ... It is easy to see that if the coordinates of this star in Almagest have an error A and if vg is its velocity, that the error in the determination t* is about A/vi. ... One can find in [1] "real errors in coordinates of stars from the Almagest star catalogue. ...
... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...
... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...
Кафедра истории зарубежной литературы . ... Педагогическая задача кафедры ? ... Выпускники кафедры преподают историю западных литератур, сравнительную историю западной и русской литературы в МГУ, других московских, российских, зарубежных университетах, а также работают в институтах РАН РФ, в ведущих библиотеках, редакциях ?бумажных? и электронных СМИ, востребованы как переводчики художественной литературы, нон-фикшн. ... Кафедра истории зарубежной литературы филологического факультета МГУ . ...
Кафедра . ... Новости . 2016 . ... Заседание кафедры молекулярной биологии состоится 6 апреля в 11.00 в 336 к. 2016 . ... Группа российских ученых при участии исследователей из МГУ имени М.В.Ломоносова выяснила, что испытываемый клетками кратковременный тепловой стресс приводит к индукции клеточного старения. ... Молекулярная биология опирается на содружество трех наук ? биологии, физики и химии. ... 2016 Кафедра молекулярной биологии . Биологического факультета МГУ им. М.В. Ломоносова . ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Географии мирового хозяйства . ... Ссылки . ... Australia : Australia New Zealand Geomorphology Group . ... Brasil: Uniao da Geomorfologia Brasileira . ... France: Groupe Francais de Geomorphologie . ... United States : Quaternary Geology and Geomorphology Division of the Geological Society of America . ... International Council for Science . ... International Union of Geological Sciences . ... International Union for Quaternary Research INQUA . ... International Union of Soil Science, ISSS . ...