... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . ... dedicated to the outstanding Russian scientists . ... Moscow, April 10-14, 2007 Welcome . ... Dorodnicyn Computing Center of RAS, Computational Mathematics and Cybernetics Faculty of the M.V.Lomonosov Moscow State University and Russian Scientific Operations Research Society will organize the Vth Conference in April 2007 in Moscow. ...
... The collection includes the results of Russian and foreign scientific researches on the contemporary condition of human resources management. ... Key words: human resources management, labor activity motivation, organizational leadership, people development in organization, efficiency of the labor activity, public administration staff, corporate training, social-and-psychological organizational climate, staff recruitment, employee appraisal. ФГУ МГУ 2016 . ...
... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...
. Laboratory Head: L.K.Gladilin, tel: (+7 495) 939 3568 , fax: (+7 495) 939 3064 , . Сотрудники Лаборатории (LHPR staff) . Web-pages: . L.K.Gladilin , . V.I.Rud , . I.A.Korzhavina , . Information for our Guests . Справка о создании и первом периоде работы лаборатории, подготовленная в 1980 г. Research Activities: . Scientific Information Search Engines : inSPIRE , ScienceResearch , Google Scholar . Scientific Servers : Interactions , AIP , Elements , Scientific . Feedback: Last modified on March 1, 2016.
30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/global2007.pdf -- 136.8 Кб -- 19.03.2008 Похожие документы
... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...
license ]] . CompHEP . Trace: license . ... This Licence entitles the Licensee (one person) and the Licensee 's research group to obtain a copy of the source or executable code of CompHEP and/or interfaces of CompHEP to other Monte-Carlo generators and to use the acquired program for academic research or other non-profit purposes within a research group; or, it entitles the Licensee (a company, organisation or computing center) to install the ... CompHEP team . ...
News from the UNESCO Chair on Global Problems Journal 1/2016 Moscow Russian Federation Lomonosov Moscow State University Faculty of Global Processes Dear colleagues, UNESCO Chairholders and members, international scientists, friends! ... When inaugurating the Chair, the Rector of the University Acad. ... The visit of the UNESCO Director General to the Moscow University represents an important milestone for the development of the multifaceted cooperation between UNESCO and the Russian Federation. ...
[
Текст
]
Ссылки http://unesco.fgp.msu.ru/wp-content/uploads/2016/02/Journal-1.2016.pdf -- 712.2 Кб -- 29.02.2016 Похожие документы
International Conference Fluxes and Structures in Fluids : Physics of Geospheres FLUXES AND STRUCTURES IN FLUIDS : PHYSICS OF GEOSPHERES International Conference PROGRAMME FLUXES AND STRUCTURES IN FLUIDS CO-SPONSORS RUSSIAN ACADEMY OF SCIENCES RUSSIAN FOUNDATION FOR BASIC RESEARCH NATIONAL SCIENCE FOUNDATION (USA) THE CONFERENCE IS ORGANISED BY ... D.M. Klimov (Russia), Prof. S. Kimura (Japan), Acad. ... Coffee Break 2-nd Morning Session 11:30 13:00 Section 1 11:30 11:45 .. ...
Muller cells are living optical fibers Ё in the vertebrate retina Kristian Franze*, Jens Grosche*, Serguei N. Skatchkov, Stefan Schinkinger§, Christian Foja¶, Detlev Schild , Ortrud Uckermann*, ... California, Berkeley, CA, and accepted by the Editorial Board March 27, 2007 (received for review December 15, 2006) Although biological cells are mostly transparent, they are phase objects that differ in shape and refractive index ... 20 8287 8292 BIOPHYSICS Fig. ... Fig. ... Cell Isolation. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Franze2007_Muller_cell_waveguide.pdf -- 1580.0 Кб -- 01.02.2014 Похожие документы
русский english MSU of Lomonosov Higher School . of Policy in Culture . and Administration in Humanities (faculty) . ... Lecturers . Faculty in the people . ... The leading representatives of Russian sport and culture are engaged in teaching at the faculty: . ... Mark A. Gurvich Chairman of Moscow Board of Theatres, . ... Higher School of Policy in Culture and Administration in Humanities (faculty Lomonosov Moscow State University) 2016 . ...
... Currently there are 27 faculties - of Mechanics and Mathematics, Computational Mathematics and Cybernetics, Physics, Chemistry, Geology, Biology ... Sociology, Institute of Asian and African Studies, Public Administration and Social Studies, Materials Sciences, Pedagogy, Arts, International Relations, Bioengineering and Bioinformatics, Continuing Education , Center for International Education The total number of students including post-graduates is currently 40,000. ...
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
... K. Krylov . There was undertaken a research of lengthes of marinon - some integral units obtained by segmenting of comleted (whole) fiction prosaic texts (stories, small novels, novels). ... Overall corpus of considereded texts (Russian fiction prosaic) contain more than two million of graphic running words. Undertaken research has lead us to revealing of three main regularities. 1) to formulation of the law of optimum relation between number of elements within each submicroscopic level; . ...
NANO AND GIGA CHALLENGES IN MICROELECTRONICS: RESEARCH OPPORTUNITIES IN RUSSIA . ... Moscow, September 11-13, 2002 . This meeting will bring together scientists and engineers from academia, industry and national labs to discuss recent developments, and explore potential for collaboration solving the most challenging scientific and engineering problems in microelectronics. ... atomic scale design: theory and experiment . highest frequency electronics . ... non-silicon materials and devices . ...
Вы посетили: inv_engl.html . ... История кафедры . ... Visiting Professor at the University of Oslo, Norway, Oslo, November, 2010 . ... Visiting Professor at the University of Ljubljana, Slovenia, August, June 2010 . ... Visiting Professor at the University of Patras and the University of Athens, Greece, June-July 2009 . ... Visiting Professor at the University of Stockholm, Sweden, January ? ... staff/guterman/inv_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...