. Name . Last modified . Size . Description . about_center/ . 14-Sep-2013 14:31 . - . sections/ . 31-Oct-2007 14:46 . - . Apache/2.2.16 (Debian) Server at educenter.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>9) - educenter.sinp.msu.ru/ )

MGU Botanic Garden . ... The MSU Botanical Garden is not only a valuable scientific institution, but also a place giving joy and a good mood to many people. ... To become a volunteer, please, fill in the application e-form and send it to the following e-mail address: . ... We will contact you on your telephone number within a week of your sending the application. Community work days are also held on the territory of the Garden for different organization and agency workers. ...

Еще в разделе: (Показать все результаты (>13) - botsad.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Human longevity at the cost of reproductive success: evidence from global data ц б F . ... Abstract A trade-off between reproduction and somatic maintenance and hence survival is fundamental to life-history theory. We investigated the relationship between female fecundity and longevity in Homo sapiens using data from 153 countries located all over the world. The raw correlation between life span and fecundity was highly signi®cant with a negative trend. ... 1998; Polis et al., ...

Еще в разделе: (Показать все результаты (>35) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Bonferroni_deMeeus.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2002_Host_manip_IJP.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1999_Seasons_EER.pdf

Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...

Еще в разделе: (Показать все результаты (>3) - cell.biophys.msu.ru/ )

... Furman and A.V.Tikhonravov, "Basics of optics of multilayer systems" , Editions Frontiers, Gif-sur Yvette, 1992, 242 p. A.V. Tikhonravov, M.K. Trubetskov, I.V. Zuev and P.G. Verly, "Efficient Refinement of Inhomogeneous Optical Coatings", in "Optical Interference Coatings", OSA Technical Digest Series, vol. ... A.V. Tikhonravov, M.V. Klibanov, I.V. Zuev, "Numerical study of the phaseless inverse scattering problem in thin film optics", Inverse problems, 1995, Vol. 11, pp. ... Основные публикации . ...

Еще в разделе: (Показать все результаты (>21) - www.srcc.msu.ru/ )

... Alexander A. Moskovsky . ... Software Designer : . ... Projects: . Janitor II, Custodian III for Matrix Logic - utilities for DOCS Open EDMS (electronic document management system), C++/Win32 platform. ~2 man-year project with 5 persons team. iBuzz - (for ibuzz.com ) large client-server system (Win32, Enterprize Java Beans, Oracle, Sun/Solaris). ... Lunch Ordering Web System. ... Software Resources International , former Digital Moscow Software Center, . ... Physical Chemistry chair, . ...

Еще в разделе: (Показать все результаты (>8) - lcc.chem.msu.ru/ )

• Laboratory of Chemical Cybernetics

О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...

Еще в разделе: (Показать все результаты (>2) - elast.math.msu.su/ )

... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1808.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2068.txt

About particularities of intensities distribution in cross-section of powerful laser beams . ... The time of the beam aperture scanning was about 10 -2 - 10 -3 s. On occasion to measure the intensity distribution in the beam cross-section the small spherical mirrors with the diameter of about 5 - 10 mm were placed instead of mirror fringes. ... Such technique allowed by character of a luminescence corundum to investigate transformations of spatial distribution of intensity in a laser beam. ...

Еще в разделе: (Показать все результаты (>9) - optics.sinp.msu.ru/ )

• НЕСТАЦИОНАРНЫЕ РЕЖИМЫ ГЕНЕРАЦИИ В ПРОТОЧНЫХ ЛАЗЕРНЫХ СИСТЕМАХ И НОВЫЕ

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>3) - www.eng.geogr.msu.ru/ )

• Selenga-Baikal research

СПИСОК ПУБЛИКАЦИЙ . ... к.ф.-м.н. Ровенской Елены Александровны . ... Е.А. Ровенская. ... E.A. Rovenskaya, V.V. Savin . ... E.A. Rovenskaya. Optimal Compatibility and Its Applications // Journal of Nonlinear and Convex Analysis, 2009, 10(1): 51-72 . ... Ю.С. Осипов, А.В. Кряжимский, Е.А. Ровенская. ... Е.А. Ровенская , А.А. Володин, В.Б. Гласко , С.В. Родионов. ... Е.А. Ровенская, А.В. Кряжимский, В.И. Максимов, М.В. Родкин . ... Е.А. Ровенская, Д.Г. Пивоварчук. ... Е.А. Ровенская, У. Лехмийоки . ...

Еще в разделе: (Показать все результаты (>15) - oc.cs.msu.ru/ )

• CURRICULUM VITAE

... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...

Еще в разделе: (Показать все результаты (>10) - www.students.chemport.ru/ )

• тест ?4 по английскому языку
• тест ?2 по английскому языку

Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH­1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' ­ an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...

Еще в разделе: (Показать все результаты (>5) - top.sinp.msu.ru/ )

системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...

256. Видеоархив МГУ имени М.В.Ломоносова | Видеозаписи МФК и другие материалы

257. http://www.hist.msu.ru/Departments/RusHis19/Staff/tarasov/Tarasov_ray.pdf

258. NPG-explorer

259. almater.ru - Этот веб-сайт продается - это наилучший источник информации по