Вы посетили: arzhantsev_publications . ... История кафедры . ... I.V.Arzhantsev, U.Derenthal, J.Hausen, and A.Laface. ... Journal of the London Mathematical Society 89 (2014), no. ... И.В.Аржанцев, М.Г.Зайденберг и К.Г.Куюмжиян. ... Математический Сборник 203 (2012), вып. ... Finite-dimensional subalgebras in polynomial Lie algebras of rank one. ... Однозначность сложения в полупростых алгебрах Ли. ... staff/arzhantsev_publications.txt Последние изменения: 12.01.2016 23:11 От arjantse | ...
LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...
[
Текст
]
Ссылки http://www.phys.msu.ru/rus/about/structure/admin/OTDEL-FOREIGN/INVITATIONS/LUT_Summer_School_2013_staff.pdf -- 448.5 Кб -- 17.01.2013 Похожие документы
The Department of Talented Youth Affairs and Professional Orientation . ... From May 15 to June 15 (2014), the design centre ?Artplay? hosts ?Robot ball? which represents an International Meeting of Modern Robots (official website: balrobotov.ru ). ... In order to participate in the ?Robot Ball?, more than 40 robots arrived in Moscow from USA, France, Germany, UK, South Korea, Japan, Russia, Canada, etc. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...
... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...
DAYS on DIFFRACTION' 2011 77 Analytical solutions for diffraction problem of nonlinear acoustic wave b eam in the stratified atmosphere Vladimir A. Gusev, Ruslan A. Zhostkow Department of Acoustics, Physical Faculty, Lomonosov's Moscow State University, Russia; e-mail: vgusev@bk.ru The nonlinear wave equation and mo dified KhokhlovZab olotskaya typ e equation for high intensive acoustics wave b eams propagating in stratified atmosphere with inhomogeneous of sound sp eed is set up. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gusev_files/diff2011.pdf -- 68.4 Кб -- 07.11.2012
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gusev_files/diff2011.pdf -- 68.4 Кб -- 07.11.2012 Похожие документы
... Правила проведения зимней экзаменационной сессии на геологическом факультете МГУ . ... Курс ориентирован на освоение студентами основных методов работы на компьютере и различных периферийных устройствах (принтеры, плоттеры, сканеры, дигитайзеры и т.д.), знакомство с существующими ... так и общего назначения) для решения конкретных геологических задач (построение различной геологической графики, работа с базами данных , моделирование геологических процессов, оформление отчетов, статей и т.п.) ...
МЕЖФАЗНЫЕ ВЗАИМОДЕЙСТВИЯ В СТОЧНЫХ ВОДАХ ОЧИСТНЫХ СООРУЖЕНИЙ . ... выпущено облако мелких частиц, сосредоточенных в При заданном начальном распределении частиц и скорости выпуска загрязнителей предполагается построить изолинии плотности смеси, поле скоростей смеси, что позволит прогнозировать концентрацию загрязняющих веществ в реке при фиксированной схеме течения и заданном сбросе загрязнителей и осуществить контроль за ходом технологического процесса на станции очистных сооружений. ...
SKOBELTSYN INSTITUTE OF NUCLEAR PHYSICS (SINP) A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION MAGNET FOR 55 MeV RACE TRACK MICROTRON MSU-SINP Preprint No 2011-2/866 1 UDC 621.039 A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov E-mail addresses: shved@depni.sinp.msu.ru DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION ... Magnetic screen system optimization.. ...
... Кафедры . ... Практика . Производственная практика 2015 . ... IS PLEASED TO WELCOME INTERNATIONAL STUDENTS TO . ... International students enjoy both a regular curriculum and an in-depth study of the Russian Language, Russian Culture and History of Russia. ... a certified Russian translation ofљ both the original of Secondary School Certificate (or equivalent) and its attachment. ... a certified copy of ID/passport (the original of ID/passport is to be produced on application) . ...
Marketing Plan Outline Canada Business Service Centres - CBSCs Last Verified: 2004-11-08 Document No. 4014 Summary A marketing plan is designed to direct company activities towards the satisfaction of customer needs; determine what the customer wants, develop a product/service to meet those needs, get the product/service to the end user and communicate with the customer - at a profit! ... levels, sales volumes? ... What is the consumer acceptance price range for this type of product/service? ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/marketingplanoutline.doc -- 131.0 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/marketingplanoutline.doc -- 131.0 Кб -- 27.10.2005 Похожие документы
... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......
... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...
[
Текст
]
Ссылки http://www.protein.bio.msu.ru/~akula/Kulaichev%20Addition.pdf -- 75.3 Кб -- 29.10.2013 Похожие документы
... Preferences . ... Date & Time . ... Time zone: Default time zone Africa/Abidjan Africa/Accra Africa/Addis_Ababa Africa/Algiers Africa/Asmara Africa/Bamako Africa/Bangui Africa/Banjul Africa ... Africa/Niamey Africa/Nouakchott Africa/Ouagadougou Africa/Porto-Novo Africa/Sao_Tome Africa/Tripoli Africa/Tunis Africa/Windhoek America /Adak America /Anchorage America /Anguilla America /Antigua America /Araguaina America /Argentina/Buenos_Aires America /Argentina/Catamarca ...
Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf -- 1182.2 Кб -- 30.11.2015 Похожие документы
Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
... Сектор информатики и биофизики сложных систем . ... О секторе . ... Учебная работа сектора включает лекции, семинары, практические занятия по информатике и математическому моделированию в биологии, биофизике, экологии на всех 5-ти курсах обучения на кафедре биофизики. ... Диффузия и взаимодействие белков в биологических мембранах? консультанты Ризниченко Г.Ю. , Рубин А.Б. Рабочие семинары сектора информатики и биофизики сложных систем проходят по четвергам в 11:00 в аудитории 124 (компьютерный класс...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Bifurcations of Equilibria in Potential Systems at Bimodal Critical Points Alexei A. Mailybaev e-mail: mailybaev@imec.msu.ru Alexander P. Seyranian e-mail: seyran@imec.msu.ru Institute of Mechanics, Moscow State Lomonosov University, Michurinsky prospect 1, 119192 Moscow, Russia Bifurcations of equilibria at bimodal branching points in potential systems are investigated. ... In this paper, we intend to give a complete theory of bimodal bifurcations in potential systems with symmetries. ...
[
Текст
]
Ссылки http://mailybaev.imec.msu.ru/papers/mailybaevseyranian2008.pdf -- 310.5 Кб -- 29.12.2008 Похожие документы