Nanoterrorism: New Responsibility for Our World and Future in the Global TechnoScience Vitaly G. Gorokhov Institute for Philosophy of the Russian Academy of Sciences, Institute of Technology Assessment and Systems Analysis of the Research Center Karlsruhe (Germany) Vitaly.Grorokhov@itas.fzk.de "Bioterrorism and chemical warfare are not unthinkable. ... 2] But these conditions do not else exist for the time being in nanoscience and nanotechnology. ...

Еще в разделе: (Показать все результаты (>6) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc
• http://www.iisi.msu.ru/UserFiles/File/bayern2014/Forum_1.pdf

.

Еще в разделе: (Показать все результаты (>34) - analyt.chem.msu.ru/ )

• Лаборатория Электрохимических Методов
• Moscow State University: Analytical Chemistry Division
• Рост числа публикаций и патентов по ИЖ

О лаборатории . ... Лаборатория теоретической биофизики . ... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... We use OPLS-AA with some includings; ?includings? are overlays on the standart GROMACS forcefield files. ... All-atom automatic OPLS-AA topology generator . ... comcon1 in All-atom automatic OPLS-AA topology? . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>17) - erg.biophys.msu.ru/ )

• Using spherical functions (from A.Granovsky manual) ERG Research Group:
• Firefly ERG Research Group: Лаборатория теоретической биофизики
• Building and plotting Fukui function with FireFly and PyMol ERG Research Group:

Cell. ... 2012) 69:1787­1797 DOI 10.1007/s00018-011-0895-z Cellular and Molecular Life Sciences REVIEW Cytochrome c: the Achilles' heel in apoptosis A. V. Kulikov · E. S. Shilov · I. A. Mufazalov · V. Gogvadze · S. A. Nedospasov · B. Zhivotovsky Received: 5 September 2011 / Revised: 30 October 2011 / Accepted: 22 November 2011 / Published online: 17 December 2011 с Springer Basel AG 2012 Abstract Cytochrome c is a well-known ... How is cytochrome c released from mitochondria? ...

Еще в разделе: (Показать все результаты (>5) - www.fbm.msu.ru/ )

• http://www.fbm.msu.ru/about/struct/labs/lima/paper1.pdf
• http://www.fbm.msu.ru/about/struct/labs/lima/paper7.pdf

... N 3 Contents Anthropology Goodkova L.K. The value of works of Y.Y. Roginsky for the development of physiological anthropology (p. 4-9) The works of Y.Y. Roginsky on variability, correlation and integrity were of great importance for the development of physiological, ecological, anthropology. ... Race of the child is also mentioned as a possible factor. Y. Roginsky was particularly interested in age changes of different anthropometric and anthroposcopic traits in children of different ethnicities. ...

Еще в разделе: (Показать все результаты (>21) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2013_4.doc
• http://www.antropos.msu.ru/vestnic/e2014_1.doc
• http://www.antropos.msu.ru/vestnic/091/3.pdf

pic] The Moscow Landscape: Architecture, Museums and Music. Course: 12 classes Fall semester, 2007 Dr. Olga Zinovieva Academy of National Economy Moscow is a huge metropolis of 10 million people with the life style typical to the most of big cities but at the same it has its unique flavor. ... The image of the city keeps changing but it has been closely connected with the political, economic and social background in Russia in general. ... Natasha's Dance : A Cultural History of Russia 17. ...

Еще в разделе: (Показать все результаты (>3) - suny.msu.ru/ )

... Submit your article . ... The article reveals peculiarities of the development of the high-tech sphere in the global economic environment. ... The role of venture ecosystem as a source of development of the high-tech sphere is examined in the article. The author identifies the problems of development of Russian venture ecosystem and demonstrates its prospects of an effective symbiosis of the state and the private initiatives against the background of favourable institutional conditions. ...

Еще в разделе: (Показать все результаты (>17) - ee-journal.spa.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• About

Monitoring of chloride and chloride-selective ion channels activity using genetically encoded fluorescent sensors. ... Quinoline-based fluorescent dyes sensitive to Cl have low biological toxicity, relatively good sensitivity and selectivity to Cl and rapid response to changes in Cl. ... Thus, development of molecules with sensitivities closer to this physiological range would provide a useful tool for monitoring Cl in biological preparations. ...

Еще в разделе: (Показать все результаты (>38) - www.msm.biophys.msu.ru/ )

• http://www.msm.biophys.msu.ru/archive/doc14886/eng.pdf
• http://www.msm.biophys.msu.ru/archive/doc14965/eng.pdf
• MSM 2007

... Place: A private EE centre (Laboratory for Optimization of Nature Exploitation LONE) and public kindergartens at Pushchino in the Moscow region. Target groups: Pre-school age children (3-6), school children (9-15), kindergarten teachers. ... In the second phase training was provided to all kindergarten teachers who volunteered to participate in the project as well as for 20 school children selected during practical courses, lectures and seminars. ...

231. SWX - Главная

232. http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf

233. Карагодина Е.Г. Антикультовое движение в Украине: психологические и правовые

234. http://www.geol.msu.ru/obsh/uch_ch2.doc

235. http://www.mse-msu.ru/Russia_2010_MSE_en.pdf

236. Start-Up Company Development :: Управление инновационной политики и организации

237. http://ndsipu.cmc.msu.ru/files/Kraev/MATLAB_FOR_STUDENTS.DOC

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда