... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>3) - www.students.chemport.ru/ )

. September 999 . Mon . Tue . Wed . Thu . Fri . Sat . Sun . 1 . 2 . 3 . 4 . 5 . 6 . 7 . 8 . 9 . 10 . 11 . 12 . 13 . 14 . 15 . 16 . 17 . 18 . 19 . 20 . 21 . 22 . 23 . 24 . 25 . 26 . 27 . 28 . 29 . 30 .

Еще в разделе: (Показать все результаты (>4490) - fmp.msu.ru/ )

• http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=9&year=1&catid=35&Itemid=1165
• http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=9&year=10&catid=35&Itemid=1165
• http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=9&year=100&catid=35&Itemid=1165

... Home News BHP meeting . Delegation of the well-known Great Britain тАУ€аAustralian Company BHP Billiton visited Chemistry Department of MSU and specifically the Laboratory of Chemical Thermodynamics on September 14, 2007. ... Colloquium on 24.10.07 . ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Colloquium on 19.10.12 15 Oct 2012 . ... Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>6) - td.chem.msu.ru/ )

• Colloquium on 08.09.10 Laboratory of Chemical Thermodynamics
• Colloquium on 23.09.10 Laboratory of Chemical Thermodynamics
• Laboratory workshop on 20.09.11 Laboratory of Chemical Thermodynamics

Cell. ... 2012) 69:1787­1797 DOI 10.1007/s00018-011-0895-z Cellular and Molecular Life Sciences REVIEW Cytochrome c: the Achilles' heel in apoptosis A. V. Kulikov · E. S. Shilov · I. A. Mufazalov · V. Gogvadze · S. A. Nedospasov · B. Zhivotovsky Received: 5 September 2011 / Revised: 30 October 2011 / Accepted: 22 November 2011 / Published online: 17 December 2011 с Springer Basel AG 2012 Abstract Cytochrome c is a well-known ... How is cytochrome c released from mitochondria? ...

Еще в разделе: (Показать все результаты (>6) - www.fbm.msu.ru/ )

• http://www.fbm.msu.ru/about/struct/labs/lima/paper1.pdf

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...

Еще в разделе: (Показать все результаты (>2) - unesco.fgp.msu.ru/ )

HERMITE FUNCTIONS EXPANSION BASED NON-LOCAL MEANS ALGORITHM FOR CT-APPLICATIONS1 N. Mamaev2, A. Lukin3, D. Yurin4, M. Glazkova5, V. Sinitsin6 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia mamaev.nikolay93@mail.ru, 3lukin@ixbt.com, 4yurin@cs.msu.ru 5,6 Federal Center of Medicine and Rehabilitation Ivan'kovskoye sh., ... Noise in CT-images is close to Gaussian [3]. ...

Еще в разделе: (Показать все результаты (>6) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.su/~yurin/Doxyfile

Bifurcations of Equilibria in Potential Systems at Bimodal Critical Points Alexei A. Mailybaev e-mail: mailybaev@imec.msu.ru Alexander P. Seyranian e-mail: seyran@imec.msu.ru Institute of Mechanics, Moscow State Lomonosov University, Michurinsky prospect 1, 119192 Moscow, Russia Bifurcations of equilibria at bimodal branching points in potential systems are investigated. ... In this paper, we intend to give a complete theory of bimodal bifurcations in potential systems with symmetries. ...

Еще в разделе: (Показать все результаты (>28) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/papers/KliemEtAl2006.pdf
• Multiparameter Stability Theory with Mechanical Applications

... MSU Chamber Orchestra . ... Concerto МГУ . ... Lidia Davydova, music director . MSU CHAMBER ORCHESTRA . Alexander Konstantinov, music director . ... Metro stations "Arbatskaja", "Okhotnyj ryad" . ... Concerto ~ MGU . Alexandr KONSTANTINOV, music director . ... Metro station Kurskaja, Gorokhovskij pereulok, 17 . ... Alexander KONSTANTINOV, music director . ... A. VIVALDI (1675-1741) Concert for strings , F-dur . ... Roman Sajgin, music director . ... MSU Chamber orchestra . ...

Еще в разделе: (Показать все результаты (>2) - music.genebee.msu.su/ )

• Bach suite

... Начало www.99ru.ru Страны и континенты Балканы 1159 . ... Введите код товара из каталога. автор PRIJATELJ, KRUNO . Хорватия Dalmatian Painting of the 14th to the 20th centuries . ... Summary: In the project "Selected questions of Dalmatian painting of the 14th to the 20th centuries" research was carried out on numerous not studied or not enough examined questions of the history of painting in Dalmatia in the cited course of time. The paintings from the 14th century were the oldest studied. ...

Еще в разделе: (Показать все результаты (>11) - www.bukivedi.ru/ )

• Ограничение нагрузки сайта
• www.99ru.ru - Rockets 15872

Сайт кафедры магнетизма Московского Университета . ... о кафедре . сотрудники . ... Радковская Анна Александровна . ... О.А. Kotelnikova, N.S. Perov, A.A. Radkovskaya, E. E. Shalygina, Faraday effect in ferrites in UHF range , Series of the Special Practicum of the Department of Magnetism, Faculty of Physics Library (Moscow University Press, Moscow, 2004). ... N.S. Perov, A.V. Bozhkov, A.A. Radkovskaya, An electro-chemical magnetic field sensor , Sensors and Actuators A Phys. 81, 351-354 (2000). ...

Еще в разделе: (Показать все результаты (>14) - magn.phys.msu.ru/ )

• РФФИ 11-02-00906, отчет 2011

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Special courses for the students of Physics Faculty, specialized at the Department. ... 32 hours, 6-th term . ... A review of characteristic ferroelectric and magnetic materials is given. ... The anomalies of physical properties in the phase transition in accordance with the crystal symmetry. ... Solid state physics . ... It is assumed that student will get knowledge about magnetic properties of such systems as molecular, clusters, nano-particles, surfaces, ultra thin films, mono- and multilayers. ...

Еще в разделе: (Показать все результаты (>10) - ferro.phys.msu.ru/ )

Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH­1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' ­ an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...

Еще в разделе: (Показать все результаты (>8) - top.sinp.msu.ru/ )

• Lev V. Dudko Additional Publications
• Bibliography

Автор: А.А. Сакбаев . ... Общая психопатология . ... Год выпуска: 1954 Автор: И.П. Павлов Ответственный редактор: П.С. Купалов Жанр: физиология Издательство: Медгиз Формат: DjVu Размер: 8.72 Мб Качество: OCR с ошибками Количество страниц: 192 . ... Литература по психологии на английском языке . Литература по анатомии ЦНС, физиологии ВНД, психопатологии. ... Флогистон / психологический блог / Литература по анатомии ЦНС, физиологии ВНД, психопатологии. ... 2 Константин Ефимов . ...

Еще в разделе: (Показать все результаты (>50) - www.flogiston.ru/ )

• Эмпатия | К.Роджерс
• Руководства пользователя на русском языке по IBM SPSS Statistics 20 | Юрий

... Photogallery: Mutorai, Evenkia, August-September 2007 . Mutorai . ... A sunny day in Mutorai . ... The river Chunia . ... Irina Mikhailovma and Anatoliy Petrovich Yastrikov with the expedition participants: Zhenia Renkovskaya and Olga Anatolievna Kazakevich . ... Anatoliy Petrovich Yastrikov . Irina Mikhailovna Yastrikova . Anatoliy Petrovich and Irina Mikhailovna Yastrikov . ... Nadia Mamontova recording the Evenki word list from Anatoliy Petrovich and Irina Mikhailovna Yastrikov . ...

Еще в разделе: (Показать все результаты (>19) - lcl.srcc.msu.ru/ )

The Department of Talented Youth Affairs and Professional Orientation . ... Projects . ... From 1 to 6 July 2014 there were held the third championship of the ?SanSat in Russia? which took place in Dubna (Moscow) ? ... CanSat is a model of microsatellite weighing about 350 grams. CanSat project started in 1999. ... Participants at the third championship were offered a large educational and excursion programs. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>14) - talant.msu.ru/ )

• International School on IT- and GRID-technologies for young scientists | The
• Robot Ball ? 2014 | The Department of Talented Youth Affairs and Professional
• From 4 to 7 February 2016 at the Faculty of Biology the first student

In the three and a half years of itтАЩs existence, the participants of the Ecological Cooperation Project have carried out more than 200 activities towards conserving and protecting the environment. ... Activities: . ... During the "We'll Conserve the EarthтАЩs Beauty" project at the Silicate lakes, near Lipetsk, the waste around a lake and in a forested area nearby was cleaned up. ... The members of ecological club from Gymnasium #1529, in Moscow, had a summer expedition to Solovetsky museum in 1999. ...

Еще в разделе: (Показать все результаты (>17) - www.ecocoop.ru/ )

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

• Best search engines for finding scientific information in the Internet:
• XAFS Publication Database search form