... Second-year students classes . ... The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... As a result, by the and this course, students acquire knowledge about the popular parallel programming techniques, knowledge of modern high-performance computing systems and practical skills to work with them. ... Moscow: Binom...
Автор: Елена Демидова . Опубликовано: August 16, 2010, 5:56 pm . Московский городской психолого-педагогический университет ( МГППУ ) . ... Адрес: Москва, ул. Сретенка, 29 , ауд.506 . ... Москва, 23 сентября 2008 г. Факультет психологического консультирования МГППУ - Профессиональная переподготовка | Москва . ... Клиент-центрированная психотерапия и личностно-ориентированный подход | ... Флогистон / новости психологии / Клиент-центрированная психотерапия и личностно-ориентированный подход | ...
The Shigeyoshi Matsumae Stadium in Moscow University was opened on September 1, 1989, on the campus of Moscow University, as the first full-scale stadium having artificial turf in the Soviet Union (at that time). ... The stadium was a gift by Tokai University to Moscow University, as the result of more than 20 years of exchange and friendship between Tokai University and Moscow University in exchanging students and teachers, as well as academic and cultural works since 1973. ...
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
... The software models the dynamics of RNA secondary structure by the means of kinetic analysis of folding transitions of a growing RNA molecule. The result of the modeling is a kinetic ensemble, i.e. a collection of RNA structures that are endowed with probabilities, which depend on time. ... 19, Moscow, 127994, Russia. ... Danilova, L.V., Pervouchine, D.D., Favorov, A.V., Mironov, A.A. (2006) RNAKinetics: a web server that models secondary structure kinetics of an elongating RNA. ...
... 23 / OPTICS LETTERS 2749 Detection of plasmon-enhanced luminescence fields from an optically manipulated pair of partially metal covered dielectric spheres Alexander Zhdanov,1 Mark P. Kreuzer,2 Satish Rao,2 Andrey Fedyanin,1 Petru Ghenuche,2 Romain Quidant,2,3 and Dmitri Petrov2,3,* ... By monitoring the luminescence of rhodamine 6G we were able to observe an increase of the local field intensity owing to the coupling of the local surface plasmons at the surfaces of two spheres. ... Fig. ...
[
Текст
]
Ссылки http://nanolab.phys.msu.ru/sites/default/files/ol33_2749_2008.pdf -- 327.6 Кб -- 16.05.2013 Похожие документы
... Дистанционное обучение . Learning and Teaching with the Web . ... Multimedia Educational Resource for Lerning and Online Teaching . ... Foreign Language Teaching Forum . Center for Enhancement of Teaching and Learning . Resources for Teaching . ... The European Association for Distance Learning . European Distance and e-Learning Network . ...
BIRD SPECIES DATABASE . of the Arctic Birds Breeding Conditions Survey . ... Queries . View list of species . ... Get list of species, for which data are available by pushing "Query" button below "View list of species" invitation. Latin name of a species can be copied from the list to the "Species name" field or typed-in there (but exactly as it appears in the species list). ... Query results will be tabulated in the window below the map, and can be browsed through or copied. ...
... Maxwell является высокопроизводительным реконфигурируемым компьютером, разработанным альянсом FHPCA для демонстрации возможностей создания вычислительных приложений на базе ПЛИС-технологий. ... Написание ядер для конкретных задач и ПЛИС. ... Для программирования ПЛИС можно использовать специальные языки описания аппаратуры (Verilog, VHDL), диалекты C, приспособленные для работы с аппаратурой, или языки более высокого уровня, которые транслируются в программы для ПЛИС. ... Задача . ...
ChangeLog for tanchiki # # Generated by Trac 0.12.5 # 04/11/16 23:02:08 Mon, 20 Dec 2010 05:36:51 GMT Peter Zotov <whitequark@тАж> [24:d7d1bdd76b7f] * tanchiki/body.py (modified) Fix body initialization. Mon, 20 Dec 2010 05:36:38 GMT Peter Zotov <whitequark@тАж> [23:30862e995add] * tanchiki/vector.py (modified) Really add null vector. Mon, 20 Dec 2010 05:32:56 GMT Peter Zotov <whitequark@тАж> [22:be41e64e5dd2] * tanchiki/game.py (modified) Make game field centered on (0,0). ...
W elcome to LHE guests page . ... 1) Enter metro station, buy a metro ticket in the ticket-office if You have not it yet. ... You will find a table with the prices near the ticket-office. ... 1) Buy a bus ticket in a kiosk near the bus stop if You have not it yet. ... It is possible to buy a ticket for 1 trip from the bus driver (28 rub). 2) Enter a bus through the front door, stick your ticket into a machine near the turnstile and take it. ... You can find more information on this site . ...
miniSTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT RF NORTHERN RESEARCH CENTER NORTH-WEST BRANCH RAMS federal service for hydrometeorology and environment monitoring (rosgidromet) MINISTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT OF ARKHANGELSK REGION territorial administration of federal service for consumers' rights protection Surveillance and human well-being in arkhangelsk region NORTHERN STATE MEDICAL UNIVERSITY [pic] NEWSLETTER of the All-Russian Science-and-Practice ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/zzx/11_2_en.doc -- 76.0 Кб -- 31.01.2011
[
Текст
]
Ссылки http://www.anthropos.msu.ru/zzx/11_2_en.doc -- 76.0 Кб -- 31.01.2011 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... One can compare the positions of these singularities and their corresponding singular variables in the Feynman diagrams which contribute to the signal process under consideration, and to both reducible and irreducible backgrounds. ... For a standard analysis using cuts on variables, one should cut hard against the regions of singularities in the background singular variables while keeping the regions with singularities for the signal singular variables (see e.g. [8]). ...
... MATHEMATICAL AND SYSTEM BIOLOGY UDC 577.1 Membrane Profile-Based Probabilistic Method for Predicting Transmembrane Segments via Multiple Protein Sequence Alignment R. A. Sutormina and A. A. Mironova a b , b, c State Research Center GosNIIgenetika, Moscow, 117545 Russia; e-mail: sutor_ra@mail ... Bioinformatics, Moscow State University, Moscow, 119992 Russia Received January 25, 2006 Abstract--Prediction of transmembrane (TM) segments of amino ... Protein Sci. ... Proteins. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/mol_biol_mosk_2006.pdf -- 151.6 Кб -- 25.05.2006 Похожие документы
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...