Supernova 2007uy and 2008D in NGC 2770 . This page is devoted to information on Supernova 2007uy and Supernova 2008D in NGC 2770 . ... Information on the original web pages for many of these images can be found on the updates and links web pages. 2007uy was discovered by Yoji Hirose (Japan)). ... 2008D was discovered by the Swift/XRT satellite which was then observing 2007uy , and announced by Lick Observatory Supernova Search (USA). ... SNWeb has a 2007uy page and 2008D page . ... JM Llapasset . ...

Еще в разделе: (Показать все результаты (>261) - www.rochesterastronomy.org/ )

• Supernova 2002fk in NGC 1309
• Supernova 2009js in NGC 918
• Discovery of Supernova 2000C in NGC 2415

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... 40 Interbrand. ґ http://www.interbrand.com/Libraries/Branding_Studies_RU/ (08.11.2012). 17 ґ http://expert.ru/2011/10/5/lyubimyie -brendyi/ (09.11.2012). 21 2 3 4 5 6 7 8 9 10 11 12 13 14 15 - 173,88 62,81 32,25 17,44 16,24 10,42 10,25 10,16 8,49 8,27 8,26 7,73 6,13 5,21 , , . ... 2011. 3 http://www.ere.net/2007/10/02/before-you-waste-your-time-and-money-on-so-called-employer-branding (28.12.2012). ... 1 , , ( ), (, ) .2 1 .. ґ http://www.marketing.spb.ru/libspecial/case/kmad_brand.htm (29.11.2012)....

Еще в разделе: (Показать все результаты (>56) - www.spa.msu.ru/ )

• Manuscript guidelines

Programme of the International Congress Globalistics-2015 : Global Governance and Diplomacy in the Unstable World dedicated to the 70th anniversary of the UN and the Year of RUSSIA's Presidency ... 26th OCTOBER 09:3011:00 Registration of the participants of the International Scientific Congress Globalistics-2015 Venue : Intellectual Centre - Fundamental Library of Moscow State University, the 1st floor hall ... P-6 Address: Leninskie Gory, 1, b.51 (Metro "Universitet"). ...

Еще в разделе: (Показать все результаты (>1565) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• Search Results пєп?п? п?п?пе п?п?. п?.п?. п?пЎп?пЎпҐпЎя?пЎп?п°

... OK ======================================= To compile CompHEP input make command ======================================= make # command output : ****************************************************************** * CompHEP -4.4p3 has been successfully built * * * * Please create a user working directory using the command * * make setup WDIR=path_to_your_user_work_dir * * NOTE: Do not use '~' to refer to home ... CompHEP-interfaces-1.0.1 has been installed successfully!! ...

Еще в разделе: (Показать все результаты (>8) - lhe.sinp.msu.ru/ )

hpc@cmc . ... Blue Gene/P . ... На сайте NCCS.gov ( http://www.nccs.gov/2008/12/19/podcast-blue-genep-workshop-july-29-31-2008/ ) выложены видеоматериалы семинара, посвященного работе с Blue Gene/P: . Blue Gene/P Workshop Intro: http://www.nccs.gov/wp-content/podcasts/BGP08_intro.wmv . Blue Gene/P Architecture (Rajiv Bendale): http://www.nccs.gov/wp-content/podcasts/BGP08_Rajiv.wmv . ... Podcast: 2008 Blue Gene/P Workshop: http://www.nccs.gov/2008/12/29/podcast-2008-blue-genep-workshop/ . ...

Еще в разделе: (Показать все результаты (>28) - hpc.cmc.msu.ru/ )

... BMC Genomics 2013, 14:476 http://www.biomedcentral.com/1471-2164/14/476 RESEARCH ARTICLE Open Access The miniature genome of a carnivorous plant Genlisea aurea contains a low number of genes and short non-coding sequences Evgeny V Leushkin1,2, Roman A Sutormin1, Elena R Nabieva1, Aleksey A Penin and Maria D Logacheva1,5* 1,2,3 , Alexey S Kondrashov 1,4 Abstract Background: Genlisea aurea (Lentibulariaceae) is a carnivorous ... Second, loss of genes could be involved. ... Plant Biol. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom2_2013.pdf

... Тексты стандартов . ... 010400 Прикладная математика и информатика . Автор: Anonymous . ... С 1 сентября 2011 года в Московском университете начинается реализация образовательных программ, разработанных на основе новых образовательных стандартов, самостоятельно установленных МГУ. Что такое образовательный стандарт? ... При этом требования таких стандартов ?не могут быть ниже соответствующих требований федеральных государственных образовательных стандартов?( ... Образовательные стандарты ? ...

Еще в разделе: (Показать все результаты (>2) - standart.msu.ru/ )

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ґ velocity potential, H ґ depth, ґ vector of bottom deformation, 0 ґ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>18) - ocean.phys.msu.ru/ )

• Index of /courses/stathyd/book by Nosov/
• Index of /courses/watercoursedyn/

... REVIEWS Measurement and Physical Content of Quantum Information B. A. Grishanin and V. N. Zadkov Received January 15, 2002 Abstract--Basic quantum information measures involved in the information analysis of quantum systems are considered. ... But today, it has become possible to intentionally vary directly quantum states of elementary quantum systems. ... 9 2002 MEASUREMENT AND PHYSICAL CONTENT OF QUANTUM INFORMATION 935 its information-equivalent copy is at the input and output. ...

Еще в разделе: (Показать все результаты (>64) - qilab.phys.msu.ru/ )

• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

... However, our studies show that Prosilica EC650 has very good p erformance to use as DIMM image detector. ... The sub-directories /opt/dimm/data/out for the output data file, /opt/dimm/data/log for the output log file yymmdd-dimm.log and /opt/dimm/etc for the configuration file must b e created. ... Pictures mode The Pictures mode provides grabbing of the star b ox images and storing their sequence as one output file "b oxrecord.fits" in /opt/dimm/data/images/ sub directory. ...

Еще в разделе: (Показать все результаты (>24) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/massug.pdf
• http://curl.sai.msu.ru/mass/download/doc/massug_eso.pdf
• http://curl.sai.msu.ru/mass/download/doc/infrasoft_eng.pdf

. Links . arXiv.org (Lanl gov) . Large amount of articles . http://arXiv.org . Scientific Electronic Library . http://www.elibrary.ru . Elsevier Science; Kluwer Academic Publishers; Springer Berlin Heidelberg . and others... Laboratory of Theoretical Nonlinear Dynamics in Institute of Radio-Engineering and Electronics of RAS, Saratov Branch IRE RAS . http://www.sgtnd.tserv.ru . Head of the group Doctor of Sciences, Professor Sergey P. Kuznetsov . Painter Andrey Isaev . http://www.IsaevArt.ru .

Еще в разделе: (Показать все результаты (>52) - chaos.phys.msu.ru/ )

... COLAMO [1] . Fire!Constructor [2], . ... Fire!Constructor ( Include COLAMO). ... 4 - Fire!Constructor COLAMO - ARGUS. ... ARGUS : Define N = 5; Define K = 6; Define M = 1; DMC[0.A] # Metka : Read A step M repeat K; Add A, K; Loop N Goto Metka; DMC[0.C] # Metka1 : Read C step M repeat K; Add C, K; Loop N Goto Metka1; DMC[0.D] # Metka2 : Read D step M repeat K; Add D, K; Loop N Goto Metka2; DMC[0.B] # Metka3 : Write B step M repeat K; Add B, K; Loop N Goto Metka3; Read ґ , (.. ...

Еще в разделе: (Показать все результаты (>2) - fpga.parallel.ru/ )

... CUBLAS и CUFFT - прикладные библиотеки, использующие CUDA для умножения матриц и преобразования Фурье. CUDA Data-Parallel Primitives Library - библиотека некоторых распространенных операций с данными, реализованных при помощи CUDA. ... ACML-GPU - процедуры математической библиотеки AMD ACML, реализованные на графическом процессоре. ...

Еще в разделе: (Показать все результаты (>3) - gpu.parallel.ru/ )

... Клуб выпускников / Доска объявлений . клуб выпускников члены клуба вступить в клуб наши партнеры . Поиск работы и вакансии . ... Для участия в разработке информационных систем для гражданской авиации (Linux, C++, Oracle) с возможностью проявить себя требуются программисты C++. ... приветствуется знакомство с Unix/Linux, SQL, любой уровень знания английского . ... премии по результатам работы . место работы - рядом с м. Динамо . ... URL: http://http://www.sirena2000.ru/sirena/about.html . ...

236. http://science.chem.msu.ru/index.php?view=article&catid=34%3Anews&id=144%3A2013-10-24-11-52-14&format=pdf&option=com_content&Itemid=57

237. Page4

238. NEW MSU Graduates Club notice board