... Co-Chairman of the Forum Deputy Secretary of the Security Council of the Russian Federation , Sergey M. BURAVLEV Co-Chairman of the Forum Adviser of the Security Council of Russian Federation , Director of Lomonosov Moscow State University Institute of Information Security Issues, Vladislav P. SHERSTYUK Co-Chairman of the Forum Special Representative of the President of the Russian Official languages: Russian, English. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2016/InfoMessageEng2.pdf -- 488.8 Кб -- 11.01.2016
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2016/InfoMessageEng2.pdf -- 488.8 Кб -- 11.01.2016
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2016/InfoMessageEng2.pdf -- 488.8 Кб -- 11.01.2016 Похожие документы
... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . ... dedicated to the outstanding Russian scientists . ... Moscow, April 10-14, 2007 Welcome . ... Dorodnicyn Computing Center of RAS, Computational Mathematics and Cybernetics Faculty of the M.V.Lomonosov Moscow State University and Russian Scientific Operations Research Society will organize the Vth Conference in April 2007 in Moscow. ...
Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...
... In commemoration of the 100th Anniversary of the birthday of Lev Semenovich Pontryagin (1908 1988), an outstanding mathematician of the 20th century, the Steklov Mathematical Institute of the Russian Academy of Sciences together with Moscow State (Lomonosov) University are organizing an international conference Differential Equations and Topology . The conference will be held in Moscow, June 17 22, 2008 . ... Differential Equations (Chairman: Academician Dmitrii V. Anosov) . ...
... TernAPI program . ... TernAPI program is designed for ternapy phase diagrams calculation by means of the convex hull method. ... Quick calculation of isobaric-isothermal sections of ternary systems phase diagrams (1-30 sec.) ... Voskov A.L., Dzuban A.V., Maksimov A.V. TernAPI program for ternary phase diagrams with isolated miscibility gaps calculation by the convex hull method // Fluid Phase Equilib . ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ...
... Borexino . ... SCIENCE AND TECHNOLOGY OF BOREXINO: A REAL TIME DETECTOR FOR LOW ENERGY SOLAR NEUTRINOS (pdf) . Solar neutrino experiments and Borexino perspectives (pdf) . Detection of Supernova Neutrinos by Neutrino-Proton Elastic Scattering (pdf) . BOREXINO: A REAL TIME LIQUID SCINTILLATOR DETECTOR FOR LOW ENERGY SOLAR NEUTRINO STUDY (pdf) . Confronting Spin Flavor Solutions of the Solar Neutrino Problem with current and future solar neutrino data (pdf) . ... CAN 2.0 стандарт (pdf) . ...
... Chemical Enzymology Department, Chemical Faculty . The M.V. Lomonosov Moscow State University, Lenin's Hills, 1/11 Moscow 119991, Russia . ... Master's Degree, Honours Degree, The M.V. Lomonosov Moscow State University, Chemical Faculty, Chemical Enzymology Department (2009) . Diploma of technical translator - chemistry (Russian-English) (2008) . ... Ph.D. Student, The M.V. Lomonosov Moscow State University, Chemical Faculty, Chemical Enzymology Department (2009 - present time) . ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Many presentations concern interesting work, but are nevertheless difficult to follow because the speaker unknowingly makes a number of presentation errors. ... Time 1 Conclusion Audience Attention Introduction Various Themes Efficient Presentation Intermediate Conclusion Intermediate Conclusion Average Presentation Figure 2 Ideal attention curve of an audience when the speaker divides his talk in recognizable parts, each summarized by intermediate conclusions. ... What is a successful poster? ...
... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...
[
Текст
]
Ссылки http://www.students.chemport.ru/materials/Philosophy/orph.pdf -- 61.0 Кб -- 15.01.2009 Похожие документы
Sbornik : Mathematics 201:3 117 Matematicheski Sbornik 201:3 320 i c 2010 RAS(DoM) and LMS DOI 10.1070/SM2010v201n03ABEH004074 Elementary equivalence of Chevalley groups over lo cal rings E. I. Bunina Abstract. It is proved that (elementary) Chevalley groups over local rings with invertible 2 are elementarily equivalent if and only if their types and weight lattices coincide and the initial rings are elementarily equivalent. ... Keywords: Chevalley groups, elementary equivalence, local rings. ...
[
Текст
]
Ссылки http://halgebra.math.msu.su/wiki/lib/exe/fetch.php/staff:bunina:bunina_proofs.pdf -- 314.0 Кб -- 13.02.2013 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
. Lab . Main page News People . ASA . Master . Master net Homepage . Login . Enter your username and email address. Your new password will be sent to your email . Username: . Email: .
Аннотированные англоязычные сокращения . ... программа решения пятидиагональных несимметричных линейных систем со спектром, лежащим в полуплоскости Re; реализует алгоритм Мантеффеля; имеется возможность для ускорения сходимости использовать стабилизированное частичное LU - разложение матрицы системы; разработана в ACCU, Нидерланды . ... пакет программ для решения систем линейных алгебраических уравнений итерационными методами, разработанный в университете штата Техас в г.Остине, США . ...
... It was necessary to construct quite a different type of parachute to be light, compact, encased in a parapack and reliable. At first most parachute designers considered it to be hardly possible for a canopy to open in the air without the aid of some special devices, such as an umbrella spokes, compressed air or powder explosive charges. ... Later on a great number of different parachute systems were worked out and introduced by Russian parachute designers Nikolai Lobanov, Igor Glushkov and others. ...
... Клуб выпускников / Члены клуба / Обновление данных . клуб выпускников члены клуба вступить в клуб доска объявлений наши партнеры . Если Вы забыли пароль, укажите ФИО и факультет, и пароль будет выслан на Ваш e-mail. ...
... Клуб выпускников / Члены клуба / Обновление данных . клуб выпускников члены клуба вступить в клуб доска объявлений наши партнеры . Если Вы забыли пароль, укажите ФИО и факультет, и пароль будет выслан на Ваш e-mail. ...