Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...
MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...
Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
ITPM MSU . Quantum Computing Page . ... Quantum Computation/Cryptography at LosAlamos . Quantum Information at Los Alamos National Laboratory . Laboratory for Theoretical and Quantum Computing ( Universite de Montreal ) . Quantum information and quantum computation at IBM . ... Centre for Quantum Computation . Quantum Information Page . Quantum Information and Computation . ... Quantum Information and Quantum Computing (by Reinhard F. Werner) . ... c) ITPM MSU 1998, 1999 ...
... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...
Chemistry of Heterocyclic Compounds, Vol. ... 8, 1995 INSTRUCTIONAL TECHNIQUE IN HETEROCYCLIC CHEMISTRY COMPUTER ANIMATION: A NEW METHOD AND REPRESENTATION IN HETEROCYCLIC FOR TEACHING, OF KNOWLEDGE COMMUNICATION, ABOUT REACTIONS CHEMISTRY E. V. Babaev We propose the use of computer animation techniques .for representation of knowledge about organic reactions, in particular as applied to syntheses and transformations of heterocTcles. ... Let us briefly consider the capabilities of this program. ...
Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...
... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...
... Conferences . ... International Conference "V Bredikhin Reading 2014", Zavolzhsk, Russia, May 12-16, 2014 (L.A. Egorova). 5th European Conference for Aeronautics and Space Sciences - EUCASS 2013, Munich, Germany, July 1-5, 2013 (V.I. Sakharov). International Conference "Near Earth Astronomy-2013", Agoy, Krasnodar region, Russia, October 7-11, 2013 (L.A. Egorova). ... International Meteor Conference 2012, La Palma Island, Canary, Spain, September 20-23, 2012 (L.A. Egorova). ...
... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...
Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf -- 258.4 Кб -- 09.07.2007
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf -- 258.4 Кб -- 09.07.2007 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... MSU Chamber Orchestra . ... 2001/2002 season: . ... Concert Hall of Sheremetev's Palace . ... Lidia Davydova, music director . MSU CHAMBER ORCHESTRA . Alexander Konstantinov, music director . ... Metro station "VDNH" . ... Сoncerto e-moll, for violin and strings . ... Сoncerto g-moll, for cello and strings . ... Music from "The Fairy Queen" . Metro station "Universitet", buses # 1, 113, 119, 661 (station "Dom kultury MGU"). ... P.I. Chajkovsky Concert Hall . ... The Early Music Theatre . ...
M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o љ44'.767љN; Longitude = 42 o љ31'.417љE; Altitude = 2067љm MASTERљIIљ(8љsquareљdegress) + MASTERљVWF(VeryљWideљFieldљCameras (FOV=800 square degrees, Timeљresolutionљupљtoљ150љms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...
NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...