... Measurement of the MASS detectors parameters with mass program January 24, 2015 [112707] . MASS/DIMM electronics. ... Turbina-core(D): Dimm User Guide. ... N.Shatsky, V.Kornilov, The revision of the MASS/DIMM star catalogue. ... О.Возякова, В.Корнилов, Н.Шатский, Новое программное обеспечение прибора MASS/DIMM. ... V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site. ...

Еще в разделе: (Показать все результаты (>22) - curl.sai.msu.ru/ )

... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf
• http://rnp-group.genebee.msu.su/pdfs/febsz.pdf

... Bohm limit DB=vrg/3: Emax Emax ush 0.3 Ze B Rsh c 1014(B/Bism) Z eV B Hillas criterion ! ... Voelk 2000; Kang Jones 2006) - Bohm diffusion in amplified magnetic field B2/8 = 0.035 u2/2 ( Voelk et al. 2005 empirical; Bell 2004 , Zirakashvili VP 2008 theoretical) - account for Alfvenic drift w = u + Va upstream and downstream - relative SNR rates: SN Ia : IIP : Ib/c : IIb = 0.32 : 0.44 : 0.22 : 0.02 Chevalier 2004 , Leaman 2008, Smart et al 2004, Berezinsky et al 2006 Das et al. ...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/horns_vhe.pdf

... Russian: ps 2 pages . Published in: Russian Math. Surveys 57 (2002), no.3. ... English: ps (gzipped) 41 pages . ... Finitely presented groups and semigroups in knot theory. Russian: ps (gzipped) tex . English: ps (gzipped) tex . ... Russian: ps (gzipped) English: ps 20 pages . arXiv.org e-Print archive: http://arXiv.org/abs/math.RA/0205042 . ... Russian: ps English: ps 11 pages . ... In this paper we introduce and study gauge-equivariant $K$-theory groups $K_\GR^i(Y)$. ...

Еще в разделе: (Показать все результаты (>138) - higeom.math.msu.su/ )

• INVITED ADDRESSES:
• Alexey Garber
• Publications (Russian)

... Chemical Department . ... 7 (495) 939-31-70, Fax: +7 (495) 939-31-70, +7 (495) 939-54-17 . ... 1999 - 2004 . Master's Degree, The M.V. Lomonosov Moscow State University, Chemical Faculty, Chemical Enzymology Department (2004) . ... Strong background in Chemistry (Biochemistry, Organic chemistry, Analytical chemistry, Inorganic chemistry, Physical chemistry, Chemistry of polymers, Radio-chemistry), biochemistry, molecular biology, Physics (course of Theoretical physics, the Theoretical mechanics) . ...

Еще в разделе: (Показать все результаты (>152) - www.enzyme.chem.msu.ru/ )

• Group of microbial biochemistry and biotechnology
• Article

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

... Conferences . ... International Conference "V Bredikhin Reading 2014", Zavolzhsk, Russia, May 12-16, 2014 (L.A. Egorova). 5th European Conference for Aeronautics and Space Sciences - EUCASS 2013, Munich, Germany, July 1-5, 2013 (V.I. Sakharov). International Conference "Near Earth Astronomy-2013", Agoy, Krasnodar region, Russia, October 7-11, 2013 (L.A. Egorova). ... International Meteor Conference 2012, La Palma Island, Canary, Spain, September 20-23, 2012 (L.A. Egorova). ...

Еще в разделе: (Показать все результаты (>8) - lab106.imec.msu.ru/ )

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>30) - hit-conf.imec.msu.ru/ )

... The notion of convergence to zero in a vector space allows one to define convergence to any p oint by using a translation. ... The notion of a converging sequence can b e introduced without any top ology, by the definition of all sequences converging to some p oint. ... 1, then the sequence n xn converges to zero. ... In the case of the Euclidean top ology, where for at least one comp onent the inequality ci > 1/4 holds, the set J (f ) coincides with the whole space and hence the Julia set is empty....

Еще в разделе: (Показать все результаты (>32) - shamolin2.imec.msu.ru/ )

Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...

231. Appendix: Scaliger's List of Eras

232. Факультет иностранных языков МГУ им.М.В.Ломоносова

233. publications

234. Search of novel crystalline materials

235. Публикации по проекту