... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...
... 07.04.2016 (Thursday) Session 1 10:00-10:20 10:20-10:40 10:40-11:00 11:00-11:20 11:20-11:40 (chairman M. Stynes) N. Kopteva V. Andreev H.-G. Roos S. Franz, H.-G. Roos A posteriori error estimates for singularly perturbed reactiondiffusion problems on anisotropic meshes. ... Numerical solution of a singularly perturbed initial-boundary value problem with a Neumann condition for a parabolic equation. ... Boundary layer solutions to time-periodic singularly perturbed parabolic problems. ...
[
Текст
]
Ссылки http://math.phys.msu.ru/data/283/Programme_13th_Workshop.pdf -- 621.4 Кб -- 05.04.2016 Похожие документы
... О кафедре . ... Сотрудники . ... На кафедре работают 55 преподавателей и научных сотрудников, среди которых 13 профессоров и 19 доцентов, 17 сотрудников кафедры являются докторами и 36 - кандидатами наук. ... Родилась 24 февраля 1980 г. Закончила физический факультет МГУ в 2003 г. Кандидат физ.-мат. наук с 2006 г. Ведет семинары по высшей математике на 1-3 курсах. ... физики" href="/stud_gen/22">Методы математической . ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...
... Your girlfriend is ... than George's. much more beautifuler . ... Much of London ... by fire in the seventeenth century. destroyed . ... John prefers .... travelling by air to travelling on train . ... English, this year he .. ... Yesterday I bought a ... shirt. white new cotton . ... The professor said that .... the students can turn over their reports on Monday . the reports on Monday could be received from the students by him . the students could hand in their reports on Monday . ...
... 2000 June 21 . Solstice Celebration . ... Each individual image highlights a different temperature regime in the upper solar atmosphere and was assigned a specific color; red at 2 million, green at 1.5 million, and blue at 1 million degrees C. The combined image shows bright active regions strewn across the solar disk, which would otherwise appear as dark groups of sunspots in visible light images, along with some magnificent plasma loops and an immense prominence at the righthand solar limb. ...
The History Faculty at Moscow State University is pleased to invite students from all nations and peoples to consider studying history with us here in Moscow. Moscow State University strives to offer its students as many opportunities as possible for learning more about the world ? ... The History Faculty at Moscow State University is ready to welcome all interested students to make Moscow their home for a period, to study with us, and to reap the benefits of an international education. ...
ORF ALEA CENTER FOR GL OB AL INTERNA TIONAL S TUDIES UNIVERSIT Y OF C ALIFORNIA, SANT A BARBAR A THE ROLE OF RELIGION IN GLOBAL CIVIL SOCIETY: THE MOSCOW WORKSHOP Lomonosov Moscow State University Moscow , Russia June 19, 2013 Sponsored by the Henry R. Luce Initiative on Religion and International Affairs Luce Moscow Workshop The Moscow workshop for the Or falea Center 's Luce Project on religion in ... Moscow State University has its own church of the Saint Tatiana. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf -- 1404.9 Кб -- 22.12.2013 Похожие документы
. Deprecated : mysql_connect(): The mysql extension is deprecated and will be removed in the future: use mysqli or PDO instead in /wcmc/lms/lms/includes/database.mysql.inc on line 31 . Warning : mysql_connect(): Can't assign requested address in /wcmc/lms/lms/includes/database.mysql.inc on line 31 . Can't assign requested address
... Начало www.99ru.ru Искусство и культура Живопись 1608 . ... Искусство . ... Искусство и культура . ... Введите код товара из каталога. автор Mackellar, Dorothea . Моя страна A SUNBURNT COUNTRY: Paintings by Beavan, Bill; Mackellar, Dorothea австралийская поэтесса альбом с иллюстрациями Beavan, Bill; . ... 1608 . Mackellar, Dorothea . ... Format: Hardcover Book condition: Very Good Minus Jacket condition: Very Good Minus Australia: Rigby Limited, 1978. ... Very Good Minus/Very Good Minus. ...
... СОСТОЯНИЕ ОЧЕРЕДЕЙ И ЗАДАЧ . ... Параметры очереди . ... Параметры задачи в очереди . ... Параметры показа . ... Очередь . все regular hdd hddmem bigmem main . ... Обновлять каждые сек. показать . ...
Optical Transport N etwork (OTN) Tutorial Disclaimer: This is a Tutorial. This is NOT a Recommendation! This tutorial has no standards significance. It is purely for educational purposes. In case of conflict between the material contained in the tutorial and the material of the relevant Recommendation the latter always prevails. This tutorial should NOT be used as a reference; only the relevant Recommendations can be referenced. Summary This document provides a tutorial for Optical Transport Network stand
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf -- 583.5 Кб -- 21.09.2015 Похожие документы
Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы