... Panoramic spectroscopy of the sample of 80 nearby lenticular galaxies is presented. ... By comparing the subsample of the S0s with the chemically distinct nuclei to the total sample of nearby S0s (Fig. 1), we have assured that the chemically distinct nuclei are always younger than the surrounding bulges: the mean age difference between the chemically distinct nuclei and their surrounding bulges is 2.8 Gyr while the age difference between the nuclei and the bulges for the whole sample is only 1 Gyr. ...
Архитектура ЭВМ и язык ассемблера . Страница поддержки курса "Архитектура ЭВМ и язык ассемблера" для 1 потока . ... Ассемблер nasm . ... Начало работы под cygwin . Установка cygwin . ... Материалы . ... Материалы лекций . ... Материалы факультатива . ... Итоги коллоквиума ?1 . ... Рис.љ ... На данном этапе у Вас явно запрашивают с какого именно сервера выкачивать cygwin (Рис.љ ... На данном этапе Вам предлагают выбрать какие именно программы будут установлены в среде cygwin (Рис.љ ...
... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...
... О КРУЖКАХ . ... МАЛЫЙ МЕХМАТ - ШКОЛЕ . ... Архив . ... Первое свое занятие математического кружка я провел в 1982 году, будучи студентом первого курса мехмата МГУ. ... Тут важно слово 'моего': свобода выбора тем и методики занятий на Малом мехмате довольно велика, другие кружки занимались совсем по-другому. Одно из главных отличий - б льшая часть времени на моем кружке уходит не на попытки школьников решать задачи, а на обсуждение решений и рассказ о связанных с темой занятия теоремах и понятиях. ...
... Клуб выпускников / Наши партнеры . ... Как разместить Ваш логотип на этой страничке . Е сли Вы хотите, чтобы мы разместили Ваш логотип на этой страничке, напишите нам письмо . И не забудьте на Вашей страничке поставить ссылку на Клуб Выпускников! ... Е сли Вы гордитесь тем, что имеете отношение к Московскому университету и хотите, чтобы об этом узнали окружающие, поместите на своей странице в Internet одну из следующих картинок! ...
... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...
Challenges of Data Processing for Earth Observation in Distributed Environments Dana Petcu Abstract. ... Earth observation (EO) is most often referring to satellite imagery or satellite remote sensing, the result of sensing process being an image or a map. ... Data Processing. ... The parallel remote-sensing image processing software PRIPS was encapsulated into a Grid Challenges of Data Processing for Earth Observation in Distributed Environments 13 service in [20]. ... Remote Sensing Grid. ...
[
Текст
]
Ссылки http://angel.cs.msu.su/~oxana/image_processing/papers/2009-02370009.pdf -- 714.4 Кб -- 30.07.2009 Похожие документы
ON NONLINEAR DYNAMICS OF THE PENDULUM WITH PERIODICALLY VARYING LENGTH Anton BELYAKOV, Alexander SEYRANIAN a_belyakov@inbox.ru, seyran@imec.msu.ru Institute of Mechanics, Moscow State Lomonosov University, Michurinsky pr. ... Keywords: Pendulum of variable length, Stability of regular rotation, Tumbling chaos, Averaging method, Stability of limit cycle, Quasi-linear oscillatory system, Basin of attraction. ... Fig. ... Thus, the first instability domain takes the form (11) Fig. ... first three terms. ...
... In Richet's experiments, a human subject was able to guess (with above chance accuracy) randomly drawn playing cards even, if no sender looked at the cards. ... For this purpose, I built a quantum based random number generator (Schmidt, 1970) that could generate the numbers 0, 1,2, and 3 in a random sequence. ... One finds that some subjects can affect the random generator under these conditions, and the effect has been confirmed by a large number of different experimenters. ... Schmidt, H. (1969a)....
[
Текст
]
Ссылки http://erg.biophys.msu.ru/erg/wordpress/wp-content/uploads/2010/04/jse_04_2_schmidt.pdf -- 123.9 Кб -- 08.04.2010 Похожие документы
... 28 октября 2011 года на 81-м году жизни скоропостижно скончался выдающийся ученый, основатель ведущей научной школы, профессор кафедры физики атомного ядра и квантовой теории столкновений физического факультета МГУ, главный научный сотрудник НИИЯФ МГУ, лауреат Ломоносовской премии Балашов Всеволод Вячеславович . ... Студенческий научный семинар кафедры физики атомного ядра и квантовой теории столкновений (312, 412 и 512 группы) проводится по средам еженедельно в 17:10, 19 корпус НИИЯФ МГУ, ауд. ...
... Correlative immunostaining with anti-tubulin antibodies and electron microscopy established that apparent free microtubules observed in vivo were not growing ends of long stable microtubules. ... A) Plus and minus ends of free MTs; (B) ends of long MTs. ... Minus ends of free MTs in PtK1 cells are stable The production of free minus ends of MTs in PtK1 cells has now been observed by three pathways: self-assembly in the cytoplasm, release from the centrosome (Keating et al., 1997) and breakage of MTs...
... This assumption is grounded in the classical theory of stationary turbulence in the limit of infinite Reynolds number (e.g. Corrsin, 1951). ... The ratio of diffusivities is obtained as a function of buoyancy Reynolds number Reb and of the density ratio R (the ratio of the contributions of heat and salt to the density stratification). ... The main results are in section 5, where potential energy components, scalar variances and turbulent diffusivities for the two scalars are examined. ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf -- 2298.1 Кб -- 11.11.2009 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Before the experiments, the algae were growing throughout the day. ... Thus, it was concluded that the effects of the toxicants on F and K were related not only to inhibition of the algae cells filtering Maximum concentrations of the examined substances that did not affect the filtering rate of daphnia in the one day experiments Toxicant Mercury Copper Led Potassium bichromate Zinc TPTC Concentration , OEL for fish µg/l industry waters 0.3 5 10 40 10 23 0.1 1 100 10 1 Based on the ...
... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...
Disjoining pressure of an electrolyte film confined between semipermeable membranes Salim R. Maduar and Olga I. Vinogradova Citation: The Journal of Chemical Physics 141, 074902 (2014); doi: 10.1063/1.4892758 View online: http://dx.doi.org/10.1063/1.4892758 View Table of Contents: http://scitation.aip.org/content/aip/journal/jcp/141/7?ver=pdfcov Published by the AIP Publishing Articles you may be interested in Order of wetting transitions in electrolyte solutions J. Chem. ... Chem.- ... Phys. Commun. ...
Sp ecific features of differential motions in the DIMM V. Kornilov, B. Safonov May 28, 2010 1 Intro duction Differential image motion monitor DIMM widely used in studies of optical turbulence, is destined to measure the integrated effect of the Earth's atmosphere on the image quality. ... In the work of Martin, they are obtained by gradual spatial filtering 1 of the power spectrum of phase perturbations in the assumption of Kolmogorov's model of the optical turbulence (OT). ...
... 000, 113 (2010) Printed 21 September 2011 A (MN L TEX style file v2.2) A universal ultraviolet-optical colourcolourmagnitude relation of galaxies I1gor V. Chilingarian1,2, and Ivan Yu. ... Received 2011 Sep 15; in original form 2011 Feb 6 ABSTRACT The bimodal galaxy distribution in the optical colourmagnitude diagram (CMD) comprises a narrow "red sequence" populated mostly by early-type galaxies and a broad "blue cloud" dominated by star-forming systems. ...
Cumulative Coordinates for Approximations of High- Order Atomic Multipole Moments in Aluminosilicate and Aluminophosphate Sieves A. V. LARIN,1 D. P. VERCAUTEREN 1 2 Laboratory of Molecular Beams, Department of ... 2000; revised 14 February 2001; accepted 19 February 2001 ABSTRACT: A scheme to obtain approximate analytical functions for the atomic distributed multipole moments of the crystallographically different atoms ... 6-21G basis (black signs); ps-21G basis (gray signs). ...