... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...
... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...
Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/reportofinvention.doc -- 166.5 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/reportofinvention.doc -- 166.5 Кб -- 27.10.2005 Похожие документы
. 000027999 . О сервере . клуб выпускников члены клуба вступить в клуб доска объявлений наши партнеры . С ервер разработан и поддерживается . Лабораторией Параллельных информационных технологий . Научно-Исследовательского Вычислительного Центра Московского . Государственного Университета им.М.В.Ломоносова. Р уководитель проекта: зам. директора НИВЦ, член-корр. РАН Воеводин Владимир Валентинович . Т елефон: (495) 939-2347 . Пишите нам .
. 000028000 . О сервере . клуб выпускников члены клуба вступить в клуб доска объявлений наши партнеры . С ервер разработан и поддерживается . Лабораторией Параллельных информационных технологий . Научно-Исследовательского Вычислительного Центра Московского . Государственного Университета им.М.В.Ломоносова. Р уководитель проекта: зам. директора НИВЦ, член-корр. РАН Воеводин Владимир Валентинович . Т елефон: (495) 939-2347 . Пишите нам .
... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Program Committee . ...
The Ecological Cooperation Project is the first large-scale children's network project in Russia. This project was founded on the principles of development and achievement of widespread nature awareness among Russian school children through the establishment and unification of numerous childrenтАЩs ecological projects. ... Nature Protected Areas . ... The Project is open for cooperative learning, and any childrenтАЩs ecological organization or group is welcome to participate. ...
... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...
[
Текст
]
Ссылки http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf -- 1512.1 Кб -- 23.03.2016
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/06/Academic-Guide-for-FGS-MSU.pdf -- 1512.1 Кб -- 27.06.2014 Похожие документы
... Объявлен 40-й конкурс научных работ молодых ученых МГУ (2015-2016 уч. г.) . Подведены итоги 39-го конкурса работ молодых ученых МГУ (2013-2014 уч. г.) . ... Подведены итоги 37-го конкурса работ молодых ученых МГУ (за 2012 г.) . Подведены итоги 36-го конкурса работ молодых ученых МГУ (за 2011 г.) . Совет молодых ученых МГУ (СМУ МГУ) является общественной организацией при Московском государственном университете имени М.В.Ломоносова и формируется из представителей различных подразделений МГУ. ...
ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...
SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...
... Московский государственный университет имени М.В.Ломоносова Меню и виджеты . ... Кафедра иммунологии сегодня . ... В пятницу, 26 февраля 2016 г., в 17-00 в М2 Биофака МГУ состоится четвертая лекция памяти профессора Александра Александровича Ярилина, выдающегося российского иммунолога, профессора и идейного вдохновителя кафедры иммунологии Биологического факультета МГУ им. М.В.Ломоносова. ... Московский государственный университет имени М.В.Ломоносова Биологический факультет Кафедра иммунологии ...
. [ Войти ] . Главная -> Фильмы -> Computer Boy . Пользователи . Демо . Деньги . Фильмы . Форум . Computer Boy . Австралия 2000 . отметить . Комедия . Триллер .
Tempus (159313-TEMPUS-I2009-1-FI-TEMPUS-JPCR) ( , FGSN), (IIT), (RC-CBU, UCL), (Ecole Normale) . ... Department of Neuroscience and Brain Technologies, Italian Department of Integrative Medical Biology, Section for Group for Neural Theory, Department des Etudes Cognitive, Finnish Graduate School of Neuroscience FGSN, the University Institute of Neurology, University College London, UK; F .C. Donders Centre for Cognitive Neuroimaging, Nijmegen, MRC Cognition and Brain Sciences Unit, Cambridge, UK. ...
... Centrosome and microtubules system, cell motility and polarization. ... Alieva I B, Vorobjev I A. Vertebrate primary cilia: a sensory part of centrosomal complex in tissue cells, but a "sleeping beauty" in cultured cells? Cell Biol Int. 2004;28(2):139-50. Vorobjev I A, Alieva I B, Grigoriev I S, Borisy G G. Microtubule dynamics in living cells: direct analysis in the internal cytoplasm. Cell Biol Int. 2003;27(3):293-4. Chernobel'skaia OA, Grigor'ev IS, Alieva IB, Vorob'ev IA. ...
... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... The head of the group was born on October the 3rd, 1941 in the Yaroslavl' region of Russia and twenty-three years later graduated from the Faculty of Physics in the Moscow State University. ... 1989), Professor of astrophysics and stellar astronomy at the Faculty of Physics in MSU (1990). ... 2005, Astronomy Letters, 31 , 160 . ... chernin@sai.msu.ru . ... Staff ...
Физический факультет МГУ . Главная . О кафедре . ... Заседание кафедры 15.10.15 . ... CrystEngComm, (2014). ... Лауреат Нобелевской премии по физике 1978 года. ... Лауреат Нобелевской премии по физике 1962 года. ... Кафедра физики низких температур и сверхпроводимости (ул. Академика Хохлова стр.8, Физический факультет, Ленинские горы д.1, ГСП-2, Москва 119991 Россия. +7 (495) 939-4811 . ... Физический факультет МГУ имени М.В. Ломоносова ї 2014 . ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... Graduated in 1963 from the Faculty of Mechanics and Mathematics (Moscow State University). ... Honorary Doctor of Tokai University (Japan), Honorary Doctor of Istanbul University (Turkey), Honorary Doctor of Mongolian University , Honorary Doctor of Hanoi National University (Viet-Nam), Honorary Doctor of Byelorussian State University , Honorary Doctor of Yerevan University (Armenia), Honorary Doctor of Tashkent University (Uzbekistan), Honorary ...