... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...
Кафедра общей топологии и геометрии . ... Публикации . ... Сипачева О.В. , The Topology of Free Topological Groups, Journal of Mathematical Sciences, vol. 131, no. 4, 2005, pp. ... Сипачева О.В. , Топология свободной топологической группы, Общая топология и топологическая алгебра. ... Резниченко Е.А. , Сипачева О.В. , The Fr\'echet--Urysohn and $\alpha_2$-properties in separable spaces, groups, and locally convex spaces, 13th Summer Conf. on General Topology and Its Applications, Mexico, 1998, pp.~ ...
... Gradual transition between collinear and bi-directional types plasmon-polariton phase matching and its influence on TKE resonances are observed by C and analyzing dependence of reflectance and TKE spectra on the azimuthal angle. ... Bottom panel: TKE spectra measured under the same conditions. ... Correlations of frequency position and shift of Fano-type resonances of the TKE spectra with the reflectance spectra prove the relationship between TKE resonances and excitation of surface magnetoplasmons....
[
Текст
]
Ссылки http://nanolab.phys.msu.ru/sites/default/files/jap113_17a942_2013.pdf -- 1575.0 Кб -- 16.05.2013 Похожие документы
... Symposium expenses . ... Abstract submission . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... The deadline for abstract submission is 20 April, 2011. The abstracts have to be sent to the Symposium web address: ed.mos2010@gmail.com . ... Arial font and single spacing should be used throughout. The title should be centered and set with 14-point bold font style. ... The main body of text should be fully justified and set in 12-point regular font style. ...
Magnetism Department MSU . ... Students . Phd students . ... On this page themes of scientific work for 2nd year students actual for this year are presented. ... Magnetic effects . New magnetic materials . ... Observation metods of domain structures in magnetic materials . ... Features of magnetic properties of amorphous materials . ... Composite materials that change their shape, dimensions and mechanical properties in magnetic field . ... Dynamical properties of vortex magnetic structures . ...
Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... The specialist programme is a first step to the science in a life of every man. On the morrow of the education, students get a specialist degree and a diploma of higher education in two languages . ... The list of enterance examinations for Mathematics and Mechanics Faculty?s entrants . ... 2016 Mechmath admission for internetional students ...
... Юрий (admin) Новости AMOS , IBM SPSS Statistics , Программа AMOS , Структурное моделирование (SEM) 2 Comments . Поступила в продажу книга Наследов А.Д. IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных 1 издание, 2013 год, 416 стр., 17х23 см (70х100/16), ISBN 978-5-496-00107-6 . Книга представляет собой практическое руководство по анализу данных с помощью самой мощной и популярной программы статистической обработки информации ? IBM SPSS Statistics 20. ...
... Название доклада печатается строчными буквами, начиная с заглавной, 14 кегль, и располагается по центру страницы. Ниже, пропуская одну строку (12 кегль), приводятся инициалы и фамилии авторов (именно в такой последовательности, между инициалами пробел не ставится). На следующей строке приводятся названия организаций, которые представляют авторы (курсивом, 10 кегль). ... Формулы набираются в редакторе формул Microsoft Equation, 12 кеглем - большой символ, и располагаются по центру строки. ...
... Студенческая Астрономическая обсерватория ГАИШ . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... For those really interested in galaxies, extragalactic astronomy or the aspects of cosmology we study, we can always find an interesting problem to work on. ... To make your work in the Group most effective, it would be useful to study the following courses read by our group members as well as the members of other groups in our and other institures. ... Student information . ...
Chlorophyll Fluorescence in vivo : A Theory (Part II). ... The model of carbon assimilation V c ( m M C m -3 s -1 ) by phytoplankton is based on light dependence of photosynthesis , which can be described by a coefficient of underwater radiation absorption by photosynthetic pigments of photosystem II in suspension of microalga a PSP (m -1 ) averaged over the spectral range of underwater radiation, where ... According this assumption the photosynthesis rate is equal to: . ...
Gamma-quanta from SNRs V.N.Zirakashvili Pushkov Institute of Terrestrial Magnetism, Ionosphere and Radiowave Propagation, Russian Academy of Sciences (IZMIRAN), 142190 Troitsk, Moscow Region, Russia Outline · Acceleration of particles at forward and reverse shocks in SNRs · Amplification of magnetic fields · Modeling of broad-band emission · Radioactivity and electron acceleration Diffusive Shock ... 2010) . ... Cosmic ray positrons can be accelerated at reverse shocks of SNRs. ...
... Web Extension to American Psychological Association Style (WEAPAS) (Rev. 1.4.3) [WWW document]. URL http://www.beadsland.com/weapas/ . Этот документ содержит дополнения к Приложению 3-A (Appendix 3-A, APA, 1994 , pp. 189-222) и использует стандарт Интернет касающийся унифицированных локаторов ресурсов (URL) ( Graham, 1995 ), используемый на World Wide Web (WWW или Web) ( W3C, 1995 ). ... Желающие использовать библиографический стиль MLA могут обратиться к Walker ( 1995 ) и Wainwright ( 1995 ). ...
Prehistoric Contacts between Hittite and Luvian: The Case of Reflexive Pronouns* Ilya Yakubovich University of Chicago The origin of the Hittite reflexive clitic = za represents an unsolved problem in Anatolian and Indo-European Studies. ... Hittite = za owes its existence to the paradigmatic generalization of the borrowed Luvian 2/3sg. reflexive clitic *=ti/*=di while the Luvian form must be derived from the Indo-Hittite dative clitic *= toi `to thee'. ... Hittite borrows Luvian *=ti/=*di. ...
[
Текст
]
Ссылки http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/refl-ucla.pdf -- 316.0 Кб -- 30.04.2010
[
Текст
]
Ссылки http://imk.msu.ru/Structure/Linguistics/yakubovich/download/refl-ucla.pdf -- 316.0 Кб -- 30.04.2010 Похожие документы
Open Conference Systems . Conference Help . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Conference . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Notation of symbols used; Bold, italic, roman... 3 te 1 MB = Member body (enter the ISO 3166 two-letter country code, e.g. CN for China; comments from the ISO/CS editing unit are identified by **) 2 Type of comment: ge = general te = technical ed = editorial NOTE Columns 1, 2, 4, 5 are compulsory. page 1 of 5 ISO electronic balloting commenting template/version 2001-10 Template for comments and secretariat observations 1 MB1 2 Clause No./ ... CLOSED: Not accepted BE Be 4.2.2 ed Corrected to "events"...
... XI--XVII . ... Ac A d e m I c r e A d I N g S Conference «Old Russian literature and television» M.V. Ivanova. old russian literature and contemporary russian television . ... e-mail: lanskoy@mail.ru. ... online. 28 2007, 13:00. http://www. expert.ru/interview/2007/03/28/pavlovsky/ 21 , , , . ... 2006, 39. http://www.expert. ru/printissues/expert/2006/39/prodazha_livejournal/print 22 , . ... 2007, 31. . ... 1917--1918 . ... Key words: Old Russian literature, plot, demonology, old printing Prologue. ...
[
Текст
]
Ссылки http://www.ftv.msu.ru/hst-notes/notes_2.pdf -- 1574.8 Кб -- 06.12.2010
[
Текст
]
Ссылки http://ftv.msu.ru/hst-notes/notes_2.pdf -- 1574.8 Кб -- 06.12.2010 Похожие документы
Spinar Paradigm and Central Engine of the All Types Gamma Ray Bursts V.Lipunov1,2,3 & E.Gorbovskoy1,2,3 1Sternberg Astronomical Institute, Moscow, Universitetsky pr. ... A spinar is a quasi-equilibrium collapsing object whose equilibrium is maintained by the balance of centrifugal and gravitational forces and whose evolution is determined by its magnetic field. ... 10 Computed energy release during the process of collapse with low angular momentum and weak magnetic field. [pic] Fig .11. ...
[
Текст
]
Ссылки http://observ.pereplet.ru/images/evgeny/magneto21jun07Eng.doc -- 683.5 Кб -- 21.06.2007 Похожие документы