... www.net.cmu.edu (Carnegie Mellon University, Pittsburgh, PA - English) - D . ... Washington, DC - English) - A* This site is a general network-troubleshooting utility; it runs BGP, ping, traceroute, and a number of other routing-related utilities. ... www.efrei.fr (Efrei's, Paris - French) - * Options for timeout, TTL, name resolution . ... English) . ... Each one has a link to a network information tool, which will do an nslookup, visual ping, 30-packet ping, or traceroute to it. ...
... The Mechanism was extensively studied and heroically publicized by the late Derek de Solla Price in a book, Gears from the Greeks (de Solla Price 1975), and a Scientific American article "An Ancient Greek Computer" (de Solla Price 1959). ... De Solla Price speculates that the mechanism is "cranked" by a now lost handle that turned a contrate (as yet unidentified) gear that in turn rotated a Sun position dial and the main drive wheel. ... Roumeliotis M at www.noc.uom.gr/mr/Antikythera/index.html 2000...
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
Dynamo Theory and Earth's Magnetic Field Paul Demorest May 21, 2001 1 Intro duction The Earth's magnetic field belongs in that class of physical phenomena which are commonplace yet also very complex. ... 3 Single Disc Dynamo Before we dive into the mess of equations and approximations that describe how fluid motion and magnetic field interact, it is useful to demonstrate a very simple system which exhibits dynamo action. ... A system without fluid motion cannot support a magnetic field indefinitely. ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf -- 266.6 Кб -- 07.12.2009 Похожие документы
... 2 (1997) 147-157 PRINCIPAL TRENDS IN MODERN ECOLOGY AND ITS MATHEMATICAL TOOLS: AN ANALYSIS OF PUBLICATIONS* E. V. BUDILOVA, J. A. DROGALINA, A. T. TERIOK.HIN Department of Biology, Moscow State University, Moscow 119899 (Russia) E-mail: lenl@ATeriokhin.home.bio.msu.ru (Received March 12, 1997) The paper deals with a scientometric analysis of publications from the journals Ecology and Ecologia (Russia) based on the ... Keywords of group С are encountered in 17% and В in 11% of papers. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1997_Scientometrics.doc -- 332.0 Кб -- 16.03.2009 Похожие документы
... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...
... Rod unfortunately was not able to come to Garmisch this year, but has been in touch with the Russian Internet community in Seoul, Sharm el Sheikh, Nairobi, and the United States, and has sent a special letter to Vladislav Petrovich. ... ICANN is working with regional associations and the Internet Society in a global training program that is raising the security awareness and skills of those DNS operators in regions where resources for such training are limited. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2010/sadowsky.doc -- 37.0 Кб -- 02.04.2012 Похожие документы
... Basic statement: "Mathematics is much clever, than Mathematician" It means, that after the scientist or engineer developed new mathematical model and designed corresponding equations, the solution to these equations produces new information unpredictable for the author! ... This vibration excites the shear wave in tissue 2 sx 2 - (ct + ) s x = Fx 2 t t Studies in Fluid Dynamics of water jet are connected with two main problems: 1. Flows in contracting nozzle forming high-speed jet. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/lecture/matmodel.pdf -- 421.8 Кб -- 18.10.2007
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/lecture/matmodel.pdf -- 421.8 Кб -- 18.10.2007 Похожие документы
FNAL SELEX experiment. ... Моя Atlas страница здесь, в МГУ. ... Страница памяти Юрия Александровича Лазарева . ... Л.Д. Ландау ? ученый, учитель, человек?(.pdf) . ... Круг Ландау: Физика войны и мира?. 2009 г., 269 стр.) ... Л.Д. Ландау?(.pdf) . 32 стр.) ... Бонсай в Москве, декабрь 2015 г. Южная Индия в январе 2011 г. Петербург в ясном октябре 2010 г. Фото на станции метро Лубянка после теракта 29 марта 2010 г. (30 марта и 6 апреля). ... Фото Гелл-Манна , выступавшего в МГУ 25.09.2007. ...
... In particular, for "symmetric weights" we have a (x)f (x) dx, where (x) is an even weight function; the degree of the polynomial for the calculation of -a weights is decreased by two times, more precisely, P (x) = x f (x2 ), where P (x) is the polynomial of degree m = 2k + , k = [m/2], for determination of the weights, f (x) is a polynomial of degree k (here [... ] is the integral part). ... Now consider particular weight functions and calculate the formulas of the 10th and 14th orders of accuracy. ...
... Subject to the MOIP Charter both natural and legal persons may become the members of the Society upon paying admission fees and acknowledging the Charter and program documents. ... Persons may be elected as the Society?s full and corresponding members on a show of hands at the Society?s Council (Presidium) meeting if nominated by a section and recommended by at least two full Society?s members. ... The Society?s full members have the following rights: . ... 2015 Moscow Society of Naturalists . ...
ABSOLUTE PROPER MOTIONS OF 331 OPEN CLUSTERS . ... The proper motions of stars in the fields of 331 open clusters were taken from Four-Million Star Catalog (4M-catalog) of positions and proper motions (Volchkov et al. ... The absolute proper motions for 21 young open clusters have been derived by comparison of precise relative proper motions of individual stars and their corresponding absolute proper motions. ... Sign of proper motions in RA . ... 0.0001 arcsec/yr . ... rms error in RA proper motion . ...
... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...
... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...
... CUDA Showcase - список приложений, использующих CUDA (на сайте NVidia). RapidMind Case Studies - примеры использования RapidMind для программирования ГПУ (и не только). AMD Stream Computing Blog - примеры использования вычислительной платформы AMD Stream Computing для программирования ГПУ от AMD. Core Image - компонент интерфейса программирования Mac OS X, использующий вычислительные мощности графического процессора для отрисовки эффектов пользовательского интерфейса. ...
... October 2, 1999 . Phi Persei: Double Star . ... Based on recent results , this artist's vision of the double star Phi Persei , 720 light years away, shows a bright, rapidly rotating massive star surrounded by a disk of gas. A small companion star orbits 100 million miles away. ... Ten million years ago the small companion was actually the most massive star in the system and because of its greater mass evolved into a giant star more quickly. ... About APOD > . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
звоните, мы в Москве(926)6667253 art-sale@mail.ru . Начало www.99ru.ru Виниловые пластинки Запад 15614 . ... Искусство . История.Философия . ... Художественные . ... История Всемирная . ... Искусство и культура . ... Другие виды искусства . ... Теория искусств.Эстетика . ... Этнография Фольклор . ... Наследие Востока . ... Фольклор . ... СССР (после 1917) . ... Введите код товара из каталога. автор Kraftwerk . ... Западных уже нет, остались кое-какие лицензионные СССР звоните, тел.сверху . ...