... Application for transmission electron microscopy investigation at EMAT Form A - Administrative data 1. ... Contact information: | ... Proposal title |max. 200 characters | ... Bright field TEM imaging | ... Electron diffraction: | ... In-situ TEM (provide temperature ranges for observations, melting temperature of | ... Provide more detailed description of the sample preparation (if necessary, max | ... Crystal structure information: | ... Provide crystallographic information (max 1/2 page): | ...

Еще в разделе: (Показать все результаты (>27) - nano.msu.ru/ )

• http://polly.phys.msu.ru/en/news/attach/2012-04-05-lectures-Farle.pdf
• http://nano.msu.ru/files/materials/VIII_2010/photoelectrochem_1603.pdf

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . ... dedicated to the outstanding Russian scientists . ... Moscow, April 10-14, 2007 Welcome . ... Dorodnicyn Computing Center of RAS, Computational Mathematics and Cybernetics Faculty of the M.V.Lomonosov Moscow State University and Russian Scientific Operations Research Society will organize the Vth Conference in April 2007 in Moscow. ...

Еще в разделе: (Показать все результаты (>12) - io.cs.msu.ru/ )

• Contacts - ORM 2007
• Abstracts - ORM 2007
• Accommodation - ORM 2007

МОСКОВСКИЙ . ГОСУДАРСТВЕННЫЙ . УНИВЕРСИТЕТ . имени . М.В.ЛОМОНОСОВА . ... ФАКУЛЬТЕТ . ... МАТЕМАТИЧЕСКОЙ ФИЗИКИ . ... Московский государственный университет . имени М.В.Ломоносова (факультет ВМК) . ... университет имени М.В.Ломоносова факультет ВМК . ... федеральное государственное бюджетное образовательное учреждение высшего образования 'Московский государственный университет имени М.В.Ломоносова' ОГРН: 1037700258694 . ... МГУ имени М.В.Ломоносова (Факультет ВМК ) . ...

Еще в разделе: (Показать все результаты (>53) - mph.cmc.msu.ru/ )

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>3) - depni.sinp.msu.ru/ )

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>7) - cell.biophys.msu.ru/ )

Эталонное тестирование окружающей среды самых больших ТЭС на твердом топливе в США. ... С. 182-192. ... Хотя эффективное управление этих типов ТЭС критическое к локальным, национальным и глобальным проблемам окружающей среды, немногие исследования сосредоточены на измерении эффективности и совершенствовании эффективности энергетики. ... При использовании многокритериальной непараметрической производственной модели (охватывающей данные анализа) определено множество протоколов эффективности. ...

Еще в разделе: (Показать все результаты (>13) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=0&ref_ind=0207000102

... Полная версия: Поколение 70х . Грация-МГУ::Форум > Общение > Литература . ... Мая 25 2007, 01:57 . Поскольку на форуме есть люди, которые любят читать литературу на языке оригинала, предлагаю вашему вниманию справочник молодежного сленга тех годов. http://www.inthe70s.com/generated/terms.shtml . Вверху страницы есть также ссылки на 80е и 90е года. ... Это текстовая версия - только основной контент. Для просмотра полной версии этой страницы, пожалуйста, нажмите сюда . ...

Еще в разделе: (Показать все результаты (>6) - grace.msu.ru/ )

• Поколение 70х - Грация-МГУ::Форум

... Home . ... Linguistic expeditions . ... People . ... Photogallery: Kislokan , Evenkia, July-August 2008 . Kislokan . Kislokan at sun - set . Kislokan after the rain . A Foggy morning in Kislokan . ... Kislokan helicopter landing site. ... People of Kislokan . ... The first medical help (Nadezhda Leonidovna Gayanchuk and Anatoliy Petrovich Mongo) . People of Kislokan with their dogs . ... Anatoliy Petrovich Mongo . ... Students participated in the expedition . ...

Еще в разделе: (Показать все результаты (>33) - lcl.srcc.msu.ru/ )

. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright ї 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>2) - wwwlib.phys.msu.ru/ )

... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>26) - qsar.chem.msu.ru/ )

• Contacts - Laboratory of Medicinal Chemistry
• Palyulin, Vladimir A. - Laboratory of Medicinal Chemistry
• Orlov, Alexey A. - Laboratory of Medicinal Chemistry

email: vladikudr@mail.ru ) , , , , , , , , , , , , , , , , , rationality, secular, metaphysics, nothing, nonexistence, nihilism, elite, global business, ideologem, values, regulatory, normative, morality, ethics, transformation, stagnation, development, progress . The paper examines the main features of postmodern liberal ideology in its association with the current crises of life values. ...

Еще в разделе: (Показать все результаты (>42) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/3/09.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/3/14.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/4/10.pdf

General Information . ... Symposium expenses . ... 14 European Symposium on Gas Phase Electron Diffraction . ... The Symposium is organized by the Electron Diffraction Laboratory and the Chemistry Department of the MSU. ... Gas phase molecular structures: theory and experiment . ... We would like to stimulate deeper interaction of gas phase electron diffraction with other research fields like molecular spectroscopy, solid state electron diffraction, and electronic structure theory. ...

Еще в разделе: (Показать все результаты (>4) - ged.chem.msu.ru/ )

... 6, February, 2015 SESSIONS OF THE WORKSHOP OF THE MATHEMATICS AND MECHANICS DEPARTMENT OF LOMONOSOV MOSCOW STATE UNIVERSITY, "URGENT PROBLEMS OF GEOMETRY AND MECHANICS" NAMED AFTER V. V. TROFIMOV D. V. Georgievskii and M. V. Shamolin UDC 51(09) (For the b eginning of the list of sessions see J. Math. ... For these coefficients, we construct a recurrent system of ordinary differential equations. ... Some problems of microp olar elasticity theory. ... Stability of nonconservative mechanical systems. ...

Еще в разделе: (Показать все результаты (>34) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-160-1.pdf
• The Deep Purple Discographies

... Properties of Stellar Populations in Isolated Lenticular Galaxies I. Yu. ... The resulting average ages of the stellar population in bulges and discs fill an entire range of possible values from 1.5 to 15 Gyr which indicates the absence in the isolated lenticular galaxies, unlike in the members of groups and clusters, of a certain epoch when the structural components are formed: they could have been formed at a redshift of z > 2 as well as only several billion years ago. ... 69 NGC 2350 No. ...

Еще в разделе: (Показать все результаты (>50) - sn.sai.msu.ru/ )

• Olga Silchenko

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Immobilized bimetallic clusters: sensors and catalysts of new generation . ... It has been shown that the catalytic clusters increases the sensor signal magnitude and reduce an operating temperature of the semiconductor sensor. ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>51) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials
• The Laboratory of chemistry and physics of sensor and
• Лаборатория химии и физики полупроводниковых и сенсорных материалов | Дирин

MEASUREMENT OF PHYTOPLANKTON PHOTOSYNTHESIS RATE USING A PUMP-AND-PROBE FLUOROMETER . ... A biophysical model was used to describe the relationship between photosynthesis, underwater radiation, and the intensity of phytoplankton fluorescence excited by an artificial light source. ... Parameters of the model that could not be measured experimentally were determined by calibrating fluorescence and radiation data against the primary production measured in the Baltic Sea by radioactive carbon method. ...

Еще в разделе: (Показать все результаты (>11) - www.biophys.msu.ru/ )

CUDA Center of Excellence NVIDIA 22 « » ­ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - « » : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>6) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>19) - hcs.cmc.msu.ru/ )

• Master programљ"Decision Engineering in Economics and Finance" | Магистерское и
• The core courses for the specialty "Applied Mathematics and Computer Science".
• Master program "Information Security and Cryptography" | Магистерское и

... opt/atlas/12.0.8/cmtsite/setup.sh -tag=<release>[,<mode>] # # projects # . opt / atlas / 12.0.8 / cmtsite /setup.sh -tag= project , release [, mode ] # # Report bugs to hn- atlas -releaseKitProblem@cern.ch , atlas -sw-installation@cern.ch . # set CMTSITE STANDALONE set SITEROOT / opt / atlas / 12.0.8 macro ATLAS_DIST_AREA ${ SITEROOT } # use optimised version by default apply_tag opt apply_tag setup apply_tag projectArea ...

Еще в разделе: (Показать все результаты (>2) - lhe.sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out