Telemetry-Based Estimate of Orientation Accuracy for the Tat'yana-2 Satellite / Aleksandrov V.V., Belen'kii A.D., Bugrov D.I., Lebedev A.V., Lemak S.S., Guerrero Sanchez W.F. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>172) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 1/2013
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 3/2012

... High Brightness RTM . ... Techniques to generate short, small emittance electron bunches of several nC at energies of several MeV are being developed to drive free electron lasers, for accelerator research, to provide short laser Thomson scattering X-ray pulses, and to generate intense coherent millimeter radiation (e.g., synchrotron, transition, etc.) ... Generating several tens of MeV beams now requires large, expensive, energy inefficient accelerators available only at large laboratories. ...

Еще в разделе: (Показать все результаты (>4) - vserv.sinp.msu.ru/ )

яЛП . id #428 . The Journal of Visualization and Computer Animation [not defined] . Common information . Periodicy: . [no information] . Impact-Factor: . [no information] . ISSN: . 1099-1778 . In print: . since 1997-01-01 till 2003-12-31 . Language: . en . Price: . single article - $1 . Classifier: . [no at all] . Comment: . From 2004: Computer Animations and Virtual Worlds . Published by . (4) . Wiley Interscience - roboUpdate . No homepage defined . No open resources defined . Close . Complain . Edit

Еще в разделе: (Показать все результаты (>324) - journals.genebee.msu.ru/ )

• JCatalog - Список журналов
• JCatalog journal list

... Further tests of the radiocarbon method of age determination (1 3, 6, 8,1 0) for archaeological and geological samples have been completed. All the samples used were wood dated quite accurately by accepted methods. ... TABLE 1 Age Determinations on Samples of Known Age . ... Specific activities for samples of known age. ... The former sample was cypress wood and the latter acacia. ... This committee advised us what samples of known age to use for testing and greatly assisted us in procuring them. ...

Еще в разделе: (Показать все результаты (>98) - hbar.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

... Роджер Пэнг (љ Roger Peng) на своем youtube-канале выложил видео 4х недель своего курса ?Computing for Data Analysis? Week 1 : . ... Data Types . ... Reading/Writing Data: Part 1 . ... The ?str? function . ... Writing Functions . ... The mapply function in R . ... Using the apply function in R . ... Plotting (base graphics) . ... Plotting with lattice . ... IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных Самые важные научные исследования последнего десятилетия. ...

Еще в разделе: (Показать все результаты (>13) - tukachev.flogiston.ru/ )

... по всему сайту по геол. сайтам в каталоге в форумах в словаре в конференциях . ... Геология >> Геохимические науки >> Минералогия | Анонсы конференций . ... И.С. Фомин / Геологический факультет МГУ . ... Российская академия наук Институт геологии Коми научного центра УрО РАН Российское минералогическое общество Международный минералогический семинар МИНЕРАЛОГИЧЕСКИЕ ПЕРСПЕКТИВЫ Уважаемые коллеги! Институт геологии Коми научного центра Российской академии наук . ... Геология . ... Минералогия . ...

Еще в разделе: (Показать все результаты (>62) - phys.web.ru/ )

... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...

Еще в разделе: (Показать все результаты (>8) - vernov-relec.sinp.msu.ru/ )

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>6) - tex.bog.msu.ru/ )

... Academic Departments . ... Partners . ... All partners . ... The topic of the seminar is The future of media and communication policy research . ...

Еще в разделе: (Показать все результаты (>95) - www.journ.msu.ru/ )

• Title :: Department of Journalism, M. V. Lomonosov Moscow State University
• International Media Management Academic Association's (IMMAA) Annual
• National association of mass media researchers (NAMMI) (president - Prof. Elena

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>49) - acoustics.phys.msu.ru/ )

... О UNИX . ... Неизменяемая страница . ... Другие действия: Показать разметку Вид для печати Сформатировать как Docbook Очистить кэш страницы ------------------------ Проверить правописание Похожие страницы Карта окрестностей ------------------------ Переименовать страницу Удалить страницу ------------------------ Подписать пользователя ------------------------ Очистить от спама Вернуть эту версию Страницы пакета Синхронизировать страницы ------------------------ ...

Еще в разделе: (Показать все результаты (>219) - uneex.mithril.cs.msu.su/ )

• Index of /static/AltDocs_linux_processes
• HelpOnProcessingInstructions - UNИX
• HelpOnXmlPages - UNИX

... 2 (1997) 147-157 PRINCIPAL TRENDS IN MODERN ECOLOGY AND ITS MATHEMATICAL TOOLS: AN ANALYSIS OF PUBLICATIONS* E. V. BUDILOVA, J. A. DROGALINA, A. T. TERIOK.HIN Department of Biology, Moscow State University, Moscow 119899 (Russia) E-mail: lenl@ATeriokhin.home.bio.msu.ru (Received March 12, 1997) The paper deals with a scientometric analysis of publications from the journals Ecology and Ecologia (Russia) based on the ... Keywords of group С are encountered in 17% and В in 11% of papers. ...

Еще в разделе: (Показать все результаты (>41) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2001_RadialMaze.doc
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2003_Envir_human_EER.pdf

() .., . . , .. (email: fomas2003@list.ru) , , , , , , , , , (), Migration, Deviation , adaptation, the Chinese migrants, criminalisation, victimition, China, Siberia, the Far East, Republic Sakha (Yakutia) . , . The article contains the results of research of migration of Chinas citizent to Yakutia. On a basis of the deviantological analysis of behavioural patterns and features of adaptation of the Chinese are revealed social problems generated by migratory processes in the region.

Еще в разделе: (Показать все результаты (>74) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2012/4/08.pdf
• http://www.socio.msu.ru/vestnik/archive/2014/1/14.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/4/10.pdf

... Commission Members . Meetings . ... Commission on Paleopedology . ... Paleopedology Symposia during the XVII INQUA Congress, Cairns , Australia , 28 July - 3 August 2007 (full list of Symposia of INQUA Commission on Terrestrial Processes, Deposits and History (INQUA TERPRO) is available at the Congress web site ). ... Conveners: Daniela Sauer ( Germany ), Edoardo Costantini ( Italy ) Pedogenic analysis of aeolian deposits : Conveners: Martin Iriondo ( Argentina ), Birgit Terhorst ( Germany ) . ...

Еще в разделе: (Показать все результаты (>9) - www.paleopedology.msu.ru/ )

• Commission on Paleopedology Discussions

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...

Еще в разделе: (Показать все результаты (>3) - unesco.fgp.msu.ru/ )

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. February 7, 1998 . COBE Hotspots: The Oldest Structures Known . ... After computer processing to remove contributions from nearby objects and the effects of the earth's motion , the map shows temperature variations in the early Universe as red "spots". These spots are the oldest, most distant structures known. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>28) - www.arcetri.astro.it/ )

... The Department of Operations Research . ... Coordinators Contacts . ... on Operations Research, . ... Moscow, April 10-14, 2007 Coordinators . ... 1) New models and methods . Prof. V.V. Morozov . ... 3) Multiple objective decision making . ... Prof. I.G. Pospelov, Prof. A.A. Shananin . ... Prof. A.A. Belolipetckiy . ... 9) Game-theoretic models . ... Symposium A: Analysis of the markets and decision making in electric power industry . ... Symposium B: Models of political decision making. ...

Еще в разделе: (Показать все результаты (>12) - io.cs.msu.ru/ )

• Traditional topics of the conference - ORM 2007
• Welcome - ORM 2007
• Abstracts - ORM 2007

... 2013/04/16 - 11:59am . Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Site map . Site search . MSU website . ... This site (RSS) . E -mail: info@hsmi.msu.ru . Phone: +7 495 932-80-73 . Fax: +7 495 932-80-73 . 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>10) - hsmi.msu.ru/ )

• School overview | MSU Higher school of management and innovation

... I would like to invite you to visit my website http://www.againstchance.webs.com/ where I present the demonstration of my invention, the device for predicting the Future. It is a computer program which reveals the reaction of the computer to the future creation of a file, and since the command to create a file can be given to the computer in accordance with the outcome of any external event, such a reaction can predict that event, too. ...

Еще в разделе: (Показать все результаты (>18) - temporology.bio.msu.ru/ )