... MAX, MAX], MAX = 3'812'798'742'493. . ... MEMCAP - (read only) CSP - Control Stack Pointer - CSPL - CSP Low ­ CSP - CSP High ­ DSP - Data Stack Pointer - DSPL - DSP Low ­ DSP - DSP High ­ EXC - Exception ­ (0 ­ ) PC - Program Counter ­ STATUS - . ... EXC==-3) && (STATUS[IE]==1))) { pushcs(STATUS); // STATUS STATUS[IE]=0; // pushcs(PC); // PC PC = m(IVBASE + EXC); // EXC = 0; } else // { if (ICL == 1) // IC locked, IC ICL=0; else // { IC = m(PC); PC = PC+3; } } // IC PC execute; . ... STATUS. ...

Еще в разделе: (Показать все результаты (>2) - ternarycomp.cmc.msu.ru/ )

... Collaborative Research Center for Cluster Ion Beam Process Technology . ...

Еще в разделе: (Показать все результаты (>114) - danp.sinp.msu.ru/ )

... Data . ... Models . Solar energetic particles . ... Neutron flux variations (RU) . ... This software computes omnidirectional, integral, or differential (in energy) fluxes of electrons and protons trapped in Earth's radiation belts for specified energy, L-value, and B/B0 range. The fluxes are obtained by an interpolation procedure from the experimental data. ... MODEL - one of following integer numbers, flux model: . ... AE4MAX, electrons, solar maximum . AE4MIN, electrons, solar minimum . ...

Еще в разделе: (Показать все результаты (>26) - smdc.sinp.msu.ru/ )

• ShielDose2 model - Space monitoring data center
• NUCLEON Experiment

. Евгений Вареник, 28 февраля 2006 . Схема Горнера вычисления значения полинома в точке. Доказательство ее оптимальности в худшем случае по числу операций "сложение" и "умножение" среди алгоритмов, использующих только эти операции. Материалы к докладу: . E.M. Reingold and A.I. Stokes, Simple proofs of lower bounds for polynomial evaluation, in: R.E. Miller and J.W. Thatcher, Eds., Complexity of Computer Computations (Plenum, New York, 1972) 21--29.

Еще в разделе: (Показать все результаты (>2) - al.cs.msu.ru/ )

Integration Formulas of Tenth Order and Higher / Aidagulov R.R., Shamolin M.V. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>76) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Instructions
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Editorial
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 4/2012

... Исследователи химического факультета МГУ представили проект моделирования молекулярной динамики опасных вирусов . ... Владимир Пентковский, известный разработчик программно-аппаратных архитектур, заслуженный исследователь Intel, обладает большим опытом создания научных коллективов в России, США и Индии. ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>58) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ | Профессор Стэнфордского университета рассказал
• MsuNews.Ru | Новости МГУ | Samsung Electronics объявляет прием на работу
• MsuNews.Ru | Новости МГУ | Директор по связям с общественностью LG Electronics

... Probe flash (energy/duration) . ... 0.01 J / 0.01 ms . ... Submersible unit (dimension/weight) . Power supply unit (dimensions/weight) . ... 300 x 300 x 50 mm / 1 kg . ... Power supply . ... The complete set of PrimProd fluorometer consists of the following mainframes: submersible probe, 12 DC on-board block power supply, IBM-compatible computer, connecting cables and cable-rope. ... Submersible probe. ... On-board power block provides the necessary voltage (42 V) supply at the submersible probe. ...

Еще в разделе: (Показать все результаты (>7) - www.biophys.msu.ru/ )

... News . UHECR news . TLE news . Lab's news . Publications . Publications UHECR . Publications on Transient luminous events . ... all news . ... UHECR SINP MSU, 2015 . ...

Еще в разделе: (Показать все результаты (>43) - uhecr.sinp.msu.ru/ )

• Photos

... Oxidative phosphorylation and respiratory control phenomenon in Paracoccus denitrificans plasma membrane. ... Changes in respiratory activity, transmembrane electric potential, and ATP synthesis as induced by additions of limited amounts of ADP and P(i) to tightly coupled inverted (inside-out) Paracoccus denitrificans plasma membrane vesicles were traced. ... The data support the kinetic mechanism of the respiratory control phenomenon. ...

Еще в разделе: (Показать все результаты (>34) - biochem.bio.msu.ru/ )

• Mitochondrial cytochrome c oxidase and control of energy metabolism:

... The bright supernova (hereafter SN) in the galaxy NGC 4527 was first sighted by S. Knight (USA) on April 13.17UT at magnitude ~14.0v. The report of the sighting was subsequently forwarded by phone to the AAVSO. ... SN 1991T. The galaxy NGC 4527 is an Sb(s)II type galaxy with an apparent Blue magnitude of 11.32 (Shapley-Ames, 1981). ... An analysis of this event utilizing visual observations by amateurs, plus a light curve is presented.. ... THE LIGHT CURVE: . ... ISN SN 1991T web page . ...

Еще в разделе: (Показать все результаты (>8) - www.rochesterastronomy.org/ )

• Supernova 2005cs in M51
• Supernova 1999aa in NGC 2595
• Discovery of Supernova 2000C in NGC 2415

Russian] . The Geophysical department at MSU Geological faculty . The laboratory of near-surface electrical prospecting . ... TES technology for 2D resistivity sounding data processing, visualization and interpretation (unpublished article). ... Resistivity sounding ( in Russian ) . ... IPI2win & IPI_res3 (Windows) ver. 3.0.1a; 7-Jan-2003 . TRF_2D (Windows) [in English and in Russian] . ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics. ...

Еще в разделе: (Показать все результаты (>40) - geophys.geol.msu.ru/ )

• Researchs
• Software for resistivity and induced polarization

. Our Atlas server news 1 (Feb 06, 2008) [Rus, utf-8] .

Еще в разделе: (Показать все результаты (>17) - lhe.sinp.msu.ru/ )

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>3) - www.ccl.msu.su/ )

• 5-th All-Russian Conference - Timetable

О лаборатории . ... Лаборатория теоретической биофизики . ... Here the guide to use RESP technique based on calculations from Firefly or GAMESS-US is presented. ... Note, that RESP algorythm will fit potential in the set of points which are selected according to $PDC group in the input-file. ... Нет комментариев " Using RESP with GAMESS-US and Firefly (PC-GAMESS) " . ... Using Firefly/GAMESS-US efficiently . ... Scannin? in Using Firefly/GAMESS-US efficiently? 2012 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>25) - erg.biophys.msu.ru/ )

• All-atom automatic OPLS-AA topology generator ERG Research Group: Лаборатория
• Building and plotting Fukui function with FireFly and PyMol ERG Research Group:
• PyMol script for scanning potential energy surfaces ERG Research Group:

Mechmath admission for internetional students . Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mathematics and Mechanics Faculty was created 1 May 1933 with a recovery of the faculty system inљ Lomonosov MSU . ... The faculty prepares high level experts of wide areas of Mathematics, Mechanics and Applying Mathematics , possessing theoretical knowledge and a technique of scientific experiment . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>5) - pk.math.msu.ru/ )

• Mechmath admission for internetional students

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

... АНАТОЛИЙ ТИМОФЕЕВИЧ ТЕРЕХИН ANATOLY TEREKHIN (TERIOKHIN) . ... Будилова Е.В., Терехин А.Т. Математическое моделирование эволюции жизненного цикла: краткая история и основные направления// Журнал общей биологии, 2010. ... Ponton F., Duneau D., S?nchez M., Courtiol, A., Terekhin A.T., Budilova E.V., Renaud F., Thomas F. Effect of parasite-induced behavioral alterations on juvenile development. ... Терехин А.Т., Будилова Е.В. , Понтон Ф., Дюно Д., Санчес М., Мур Дж., ... Терехин А.Т., Будилова Е.В . ...

Еще в разделе: (Показать все результаты (>29) - ecology.genebee.msu.ru/ )

hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>3) - hpc.cs.msu.ru/ )

... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>6) - td.chem.msu.ru/ )

... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...

Еще в разделе: (Показать все результаты (>10) - physelec.phys.msu.ru/ )