... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...
... List of complexes . ... NPIDB, Nucleic acid ? Protein Interaction DataBase provides an access to structured and organized information about all available structures of DNA ? ... Since 2003, the database is available online. ... NPIDB: nucleic acid?protein interaction database . ... An updated version of NPIDB includes new classifications of DNA-protein complexes and their families . ... Sergey Vasilyev (the main developer of the first version of the database) . ... 03-04-48476 (2003 2005) . ...
... Preliminary Analysis of the Self Similarity of the Aftershocks of the Japanese Earthquake on March 11, 2011 V. S. Zakharov Faculty of Geology, Moscow State University, Moscow, 119991 Russia e mail: vszakharov@yandex.ru, zakharov@dynamo.geol.msu.ru Received October 11, 2011 Abstract--The quantitative parameters of the self similarity of the aftershocks of the Japanese earthquake on March 11, 2011 were obtained. ... Most aftershock hypocenters were located at a depth of 2050 km. ...
[
Текст
]
Ссылки http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2012_eng.pdf -- 345.2 Кб -- 28.04.2012 Похожие документы
Poligraphic complex (printing plant) - humanitarian aid from RRU to South Ossetia A.A. Tibilov State University The printing plant is intended to make a wide range of materials - textbooks, manuals, presentations, reports, informational and commercial printed matters. ... wide color range, surpassing that of offset printing; . ... simple operation and high reliability. [pic] Besides the printer, there is a digital color copier Duplo DPS850 (Japan) size A3, in the printing complex. ...
THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Reactivity thermoelectric clathrate compounds in interaction with components of the air . The project aims to address the fundamental problems of solid state chemistry - revealing the fundamental regularities of the reactivity of crystalline phases in reactions with air components and processes of formation of oxide layers (coatings) for new materials. ...
Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/global2007.pdf -- 136.8 Кб -- 19.03.2008 Похожие документы
Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Phase range for plots: -0.5 to 1.0 0.0 to 2.0 0.0 to 1.0 . ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... Two period search methods are currently implemented. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . ...
... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...
... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...
Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... The 2016 Beacon Satellite Symposium will be held at the International Centre for Theoretical Physics (ICTP) at Trieste, Italy, from 27 June to 1 July 2016. ... Абстракты - 15/02/2016 . Подробнее на сайте: http://t-ict4d.ictp.it/beacon2016 . Конференция "Распространение радиоволн" имеет более чем 40-летнюю историю и проводится раз в два-три года в центральных городах России. 15 декабря 2015 г. - начало регистрации участников и представления текстов докладов . ... D.Физика атмосферы . ...
... Furman and A.V.Tikhonravov, "Basics of optics of multilayer systems" , Editions Frontiers, Gif-sur Yvette, 1992, 242 p. A.V. Tikhonravov, M.K. Trubetskov, I.V. Zuev and P.G. Verly, "Efficient Refinement of Inhomogeneous Optical Coatings", in "Optical Interference Coatings", OSA Technical Digest Series, vol. ... A.V. Tikhonravov, M.V. Klibanov, I.V. Zuev, "Numerical study of the phaseless inverse scattering problem in thin film optics", Inverse problems, 1995, Vol. 11, pp. ... Основные публикации . ...
каталог arxiv:0812.3349 Обновленный спектральный каталог гамма-всплесков по данным INTEGRAL (The updated spectral catalogue of INTEGRAl gamma-ray bursts) . ... Authors: A. J. Barger et al. ... Authors: K. Abazajian et al., for the SDSS . ... Authors: I.A.G. Snellen et al. arxiv:0812.0014 XMM-Newton обнаружил 2.6-секундные пульсации в источнике мягких повторяющихся гамма-всплесков SGR 1627-41 (XMM-Newton discovery of 2.6 s pulsations in the soft gamma-ray repeater SGR 1627-41) . ...
fields; $sql = "update data set "; for($i=0; $i SQL: . Error: " Спасибо за заполнение анкеты! ... addField(new FormField("newlastname", "Сегодняшняя фамилия . addField(new FormFieldTextArea("interest_prof", "Профессиональные . addField(new FormFieldTextArea("children", "Дети . ... Информация из полей, отмеченных красным цветом, не будет вывешена на сайте в открытом доступе, она будет использоваться по мере необходимости лишь внутри нашего сообщества (для экстренной связи друг с другом). ...