... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

... Phys. 48 (2000) 5 ± 7, 637 ± 641 ± ± Generation of Entanglement in a System of Two Dipole-Interacting Atoms by Means of Laser Pulses I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Abstract Effectiveness of using laser field to produce entanglement between two dipole-interacting identical twolevel atoms is considered in detail. ... 6] R. G. Brewer, Phys. Rev. A 52 (1995) 2965. ...

Еще в разделе: (Показать все результаты (>63) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA-2000-61-52305-en.pdf
• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

... Symposium expenses . ... Abstract submission . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... The deadline for abstract submission is 20 April, 2011. The abstracts have to be sent to the Symposium web address:  ed.mos2010@gmail.com .  ... Arial font and single spacing should be used throughout. The title should be centered and set with 14-point bold font style. ... The main body of text should be fully justified and set in 12-point regular font style. ...

Еще в разделе: (Показать все результаты (>14) - ged.chem.msu.ru/ )

THE ROLE OF DEVELOPING NATION TOWARDS COMBATING THE CYBER CRIME Abhishek Vaish and Satya Prakash, Indian Institute of Information Technology, Allahabad. ... Highlights on the recent trends: A report of Indian computer Emergency Response Team (CERTIN) shows that more than 2500 incidents were registered and handled in the year 2008. ... Others security incidents reported in the year 2004 was 4, in the year 2005 was 18, in the year 2006 was 17, in the year 2007 was 264 and in the year 2008 was 94. ...

Еще в разделе: (Показать все результаты (>6) - www.iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2010/sadowsky.doc

. M. Prohorow, S. Kuranow . D. Kosenko stand . against background . of Donguz-Orun . At the mountain . Cheget . From the mountain . Cheget . Return from Azau . Walk with Darja Kosenko . along Cheget Slopes . Into Andyrchi to the . Ga-Ge-neutrino-detector . Scintillator-detector . W. Lukash, M. Prohorow, . D. Kompaneetc and i were . waiting for airplain . The day of waiting . for airplain . The Great Seven

Еще в разделе: (Показать все результаты (>14) - astrometric.sai.msu.ru/ )

• Symbolic circuit processor
• Symbolic matrix processor
• AMT articles

... About hotel . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! ... Great stay! dns_support@antihotmail.com . ... Great hotel! ... best place in Murmansk that I've stayed! ... Stay was great. ... Always nice to have a good nights rest while enroute to my destinations. ... Very nice place . ... What a beautiful place, we enjoyed our stay! ... Best place ever! ... Next time we visit Murmansk we will definitely stay in this hotel. ... Good ....

227. Ryabov

228. Institute of Computer Sciences - Conferences - International Conference "Metric

229. Магистратура ВМК МГУ - подготовка ERP-программистов, консультантов SAP

230. The Early Music Theatre -- The Prophetess (The History of Dioclesian)

231. pyotr.guru.ru