Emb edding formulae for diffraction by wedge and angular geometries B y R. V. Craster1 A. V. Shanin 1 2 2 Department of Mathematics, Imperial Col lege of Science, Technology ... London SW7 2BZ, U.K. Department of Physics (Acoustics Division), Moscow State University, 119992, Leninskie Gory, Moscow, Russia Embedding is the process of taking the far field directivity from a diffraction problem (or problems) involving line sources or multipoles placed at a sharp ... The Wedge, pp. ...

Еще в разделе: (Показать все результаты (>45) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/prsla02.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/valyaev10.pdf
• http://acoustics.phys.msu.su/teachers/rudenko_files/98sweisarv.pdf

miniSTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT RF NORTHERN RESEARCH CENTER NORTH-WEST BRANCH RAMS federal service for hydrometeorology and environment monitoring (rosgidromet) MINISTRY OF HEALTHCARE AND SOCIAL DEVELOPMENT OF ARKHANGELSK REGION territorial administration of federal service for consumers' rights protection Surveillance and human well-being in arkhangelsk region NORTHERN STATE MEDICAL UNIVERSITY [pic] NEWSLETTER of the All-Russian Science-and-Practice ...

Еще в разделе: (Показать все результаты (>24) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/pravila_eng.doc
• http://www.antropos.msu.ru/vestnic/e2014_1.doc

... Menzerath's Law for Morphemic Structures of Words: . A Hypothesis for the Evolutionary Mechanism of its Arising and its Testing . Anatoliy A. Polikarpov . ... Key words: Menzerath's Law, morphemic structures, language evolution . ... In this paper there is present (1) a hypothesis for understanding the evolutionary mechanism responsible for the Law arising and (2) some data for testing the hypothesis. ... A Hypothesis. ... Altmann, G. Prolegomena to Menzerath's Law//Glottmetrika 2. ...

Еще в разделе: (Показать все результаты (>48) - old.philol.msu.ru/ )

• Basic Assumptions about a Sign's Life Cycle for Mathematical Modelling of
• MSU-LGCLL:: Krylov J.K. - On the Nature of Koehler's Effect
• Large transportation networks with finite-dimensional state space. Asimptotic

ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>4) - www.cmc-online.ru/ )

... A dimension that, arguably, has so far not received the attention it deserves, namely: the role of research and education in fighting the spread of terrorist ideology and enhancing information security. ... To conclude, I will make some concrete suggestions about what kind of research we need and what kind of educational programmes we should develop to address the spread of terrorist ideology and to enhance cyber security. ... Ideology can potentially play different roles in the context of terrorism...

Еще в разделе: (Показать все результаты (>11) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/global_dns.pdf
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc

. This part of the Conference site contains photos from opening ceremony, talks, and so on. We apologize for the quality of some photos taken in extremely hard light conditions.

Еще в разделе: (Показать все результаты (>38) - dfgm.math.msu.su/ )

• Photo archive of the Conference dedicated to the memory of Professor Yu. P.
• February 18

... A member of the Russian Academy ofsciences, a great physicochemist,and a world-renowned Professor Boris Vladimirovich Derjaguin died on May scientist, he laid the foundation of the modern science of colloids and surfaces. ... B. V. Derjaguin became known world-wide in scientific circles for his work on the stability of colloids and thin films of liquids which is now known as the DLVO theory, after the initials of its authors: Derjaguin, Landau, Verwey, and Overbeek. ...

Еще в разделе: (Показать все результаты (>27) - nanofluidics.phys.msu.ru/ )

• Laboratory of Micro- and Nanofluidics

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... See general instruction in TWiki . ... As 'root' do (replacing ~rud/ by your user name) : chmod a+x ~rud/j2sdk-1_4_2_14-linux-i586-rpm.bin cd ~rud/ ./j2sdk-1_4_2_14-linux-i586-rpm.bin [Agree with licence agreement] rpm -Uvh j2sdk-1_4_2_14-linux-i586.rpm mkdir /gLite cd /gLite tar zxf ~rud/gliteUI_WN-PPS-2007-05-30.tar.gz tar zxf ~rud/gliteUI_WN-userdeps-PPS-2007-05-30.tar.gz ls /gLite boost classads d-cache edg etc glite globus gpt lcg 5. ...

Еще в разделе: (Показать все результаты (>9) - lhe.sinp.msu.ru/ )

• Information for our Guests

... Earth plasma sheet quite rapidly in the form of kinetic energy of the earthward ~owing ions[ Braking of these BBFs results in the ~ow of the electric currents associated with the substorm current wedge cf Shiokawa et al[\ 0886^ Slavin et al[\ 0886#[ In order to provide su.cient energy for the substorm process in the near ! Earth plasma sheet\ a signi_cant volume of the center of the magneto! tail must be _lled with BBFs[ Future multi!satellite studies in ...

Еще в разделе: (Показать все результаты (>88) - www.kosmofizika.ru/ )

• A Dictionary of Measures, Units and Conversions
• Полярные сияния - фотоархив

ELSEVIER Bioelectrochemistry and Bioenergetics 35 (1994) 39-47 Modelling of the effect of a weak electric field on a nonlinear transmembrane ion transfer system G.Yu. ... Aksyonov Biological Faculty of Moscow State University, 119899Moscow, Russian Federation Abstract A mathematical modelling of the K+ /H+ antiport system was carried out to investigate the influence of a weak low-frequency applied periodic electric field on ion flux via a carrier across the lipid membrane. ... Its fre- w Fig. ... Fig. ...

Еще в разделе: (Показать все результаты (>35) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3343.pdf
• http://library.biophys.msu.ru/PDF/3333.pdf
• http://library.biophys.msu.ru/PDF/3345.pdf

... Head of the Department of Emission-line Stars and Galaxies of SAI MSU . ... Structure and kinematics of galaxies . ... Strasburg Database . Hubble Telescope Archive . ... CFHT Archive . ... Chinese evolutionary synthesis Yunnan . Korean evolutionary synthesis Yonsei . Evolutionary synthesis database BaSTI . ... Electronic Journal "New Astronomy" . Electronic Astrophysical Journal . Electronic Astronomical Journal . ... Questions and comments send to Olga Sil'chenko olga@sai.msu.su ...

Еще в разделе: (Показать все результаты (>41) - sn.sai.msu.ru/ )

. Updated: 20.08.2009

234. http://srd.sinp.msu.ru/nymmik/models/bazilevskaya_1.pdf

235. Персональный фотобанк Николая Молчанова