THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
Russia 2010: Russian Transformations in the Context of World Development V.B.Kuvaldin Introduction: The Second Coming of Capitalism to Russia A quarter century has passed since the start of Gorbachevs perestroika. ... 21 World Economic Outlook. ... In this case Russia will have the opportunity to enjoy long-term growth at a rate exceeding the current trend in world economy (economic growth of about 3-4 percent a year over the last decade) and to strengthen her overall positions in world economy. ...
... 4, 2014 DOI: 10.1007/s11664-014-3031-7 г 2014 TMS Calculation of the Thermoelectric Properties of n- and p-Type Lead Telluride Using a Three-Band Model of the Electron Energy Spectrum A.V. DMITRIEV 1,2 and E.S. TKACHEVA 1 1.- ... This expression is valid for any band. ... The averaged overlap integral Calculation of the Thermoelectric Properties of n- and p-Type Lead Telluride Using a Three-Band Model of the Electron Energy Spectrum 1283 I ?k; k0 о М 2 1X hk; ijk0 ; ji 4 iМ 1 ; 2 jМ1;2 2 w DA ?k; i ...
[
Текст
]
Ссылки http://lizard.phys.msu.su/home/science/Dmitriev-Tkaceva-14-JElectMat-PbTe.pdf -- 583.7 Кб -- 07.04.2014 Похожие документы
... Метафоры, которыми мы живем . ... МИР ПОНЯТИЙ, ОКРУЖАЮЩИЙ НАС . ... букв.: ... Ориента-ционные метафоры придают понятию пространственную ориентацию; например, HAPPY IS UP 'СЧАСТЬЕ ЕСТЬ ВЕРХ'. ... Например, эмпирическое основание метафоры БОЛЬШЕ - ВЕРХ весьма существенно отличается от эмпирического основания метафор СЧАСТЬЕ - ВЕРХ или РАЦИОНАЛЬНОЕ - ВЕРХ. Хотя во всех этих метафорах фигурирует одно и то же понятие ВЕРХ, области опыта, на которых основаны эти метафоры, существенно различны. ...
... ctronic modules Detectors unit . Bicounter module . ... The base of the electronics design is the same as in original MASS: modular structure, data exchange via RS485 interface, PMTs as light detectors. ... Detailed design of the MASS electronic modules (circuit diagrams, printed circuit b oard views, their sp ecifications) is provided in the second Chapter. ... SS MOSI 6 VCC GND LINE A OVLIGHT LINE B STROB 12 13 Figure 2.2: Circuit diagram of the analog part of the Bicounter module electronics. ...
[
Текст
]
Ссылки http://curl.sai.msu.ru/mass/download/doc/new_details_v2.pdf -- 911.5 Кб -- 20.11.2008 Похожие документы
... Published in Phys.Rev.Lett.103:092001,2009. e-Print: arXiv:0903.0850 [hep-ex] Дополнительная информация доступна на странице: http://www- d0.fnal.gov/Run2Physics/top/singletop_observation/singletop_observation_upda ted.html 7) Measurement of the t-channel single top quark production cross section. ... Published in Phys.Rev.Lett.102:092002,2009. e-Print: arXiv:0901.0151 [hep-ex] Проведен анализ возможного проявления тяжелого заряженного скаляра в рождении и распаде топ-кварка. ... B672: 106-115,2009....
[
Текст
]
Ссылки http://www-hep.sinp.msu.ru/hep/images/stories/lehep_otchet_2009.doc -- 2284.5 Кб -- 16.12.2009 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia email: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the socalled V Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY YMP supercomputers. al structure of the program. ...
... The method uses calculated AMMs to calibrate approximate dependencies and allows the construction of molecular charge distribution for any sieve in two steps. ... Figure 5. (a) Electrostatic potential values (EP, au) with respect to the O2-O5-O5 plane (the three atoms are shown in the low right corner) of the XRD non optimized model of APC calculated with the STO-3G basis set; (b) electrostatic field values (EF, au); (c) EF evaluation errors presented as (1 - EFapp(L = 4)/EFcal(L = 4))(100 (%). ...
Automorphisms and isomorphisms of Chevalley groups of typ e G2 over lo cal rings with 1/2 and 1/3 E. I. Bunina M.V. Lomonosov Moscow State University Russia, 119992, Moscow, Leninskie Gory, Main Building of MSU, Faculty of Mechanics and Mathematics, Department of Higher Algebra email address: helenbunina@yandex.ru Abstract. ... We describe automorphisms of Chevalley groups of type G2 over local rings with 1/2 and 1/3. ... References [1] Abe E. Automorphisms of Chevalley groups over commutative rings. ...
[
Текст
]
Ссылки http://halgebra.math.msu.su/wiki/lib/exe/fetch.php/staff:bunina:autg2_eng.pdf -- 224.0 Кб -- 13.02.2013 Похожие документы
... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors such as economic, ecological and political aspects of society. ... Play. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./leigh.pdf -- 138.9 Кб -- 06.07.2014 Похожие документы
THOMSON ELECTRON X-RAY SOURCE FOR MEDICAL APPLICATIONS E.G. BESSONOV1, R.M. FESHCHENKO1*, M.V. GORBUNKOV1, V.I. SHVEDUNOV2 and A.V. VINOGRADOV1 1 2 P.N. Lebedev Physical Institute, 119991 Russia, Moscow Leninskii Prospect 53 Nuclear Physics Institute of Moscow State University, 119899 Russia, Moscow, Vorobyevy Gory Abstract A source of medical x-rays based on a 50 Mev storage ring and a quasi-continues picosecond laser is considered. ... Then the storage ring emittance is 0.1 mmmrad. ...
... Спивак М.Л. Издательские проекты 'Мемориальной квартиры Андрея Белого (1995 - 2015) // Сборник статей Государственного музея А.С. Пушкина. ... Наседкина Е.В. Материалы из фонда 'Мемориальной квартиры Андрея Белого'. ... Андрей Белый. ... Андрей Белый в изменяющемся мире: к 125-летию со дня рождения / Составители: М.Л. Спивак (ответственный редактор), Е.В. Наседкина, И.Б. Делекторская; Научный совет РАН 'История мировой культуры'; ГМП. ... Спивак М.Л. Андрей Белый - мистик и советский писатель. ...
... At resonance between the fundamental radiation and the microcavity mode in the geometry of polar magnetooptical Kerr effect, the polarization rotation for the second harmonic was found to be (18.5 ± 0.5)°/µm for the fundamental radiation with a wavelength of 825 nm. ... This corresponds to the Kerr rotation of 2 /2 18.5°/µm for 825 nm. ... Additionally, the fundamental wave undergoes Kerr rotation inside the MC layer, so that fundamental fields of both (s and p) polarizations coexist inside it. ...
[
Текст
]
Ссылки http://shg.phys.msu.ru/ruscon/articles/pdf/02_JETP_76_527.pdf -- 105.7 Кб -- 12.03.2008 Похожие документы
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013 Похожие документы
THE PROBLEM OF COUNABILITY OF HIGHEST ORDINALS . ... The first form corresponds to the geometric representation of ordinal w n as an infinite n -dimensional matrix. According traditional formulation w w = U w i , i =1, w , thus w w is w -countable union of countable ordinals so w w is countable. ... TWO METHODS OF RENUMBERING OF ELEMENTS OF ORDINALS The fist infinite ordinal w designates the set of natural numbers which is countable by definition. ... This matrix represents ordinal w (w ^ w) . ...
... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...
... В игре принимают участие 2 команды по 5 человек в каждой. ... Игра состоит из 2-х периодов по 15 раундов каждый. ... Double Elimination Bo1: Double Elimination Winners (8 команд): de_train - первый раунд Double Elimination Winners (4 команды ): de_nuke - второй раунд Double Elimination Winners (2 команды ): de_dust2 - финал виннеров Double Elimination Grand Final (2 команды ): de_nuke, в случае победы лузеров играется решающий de_train Double Elimination Losers (4 ...