... Cancellation policy for all excursions: The cancellation of the tours before May 22, 2013 - no penalty. ... Time : will be announced soon . The price includes : transfer Moscow-Suzdal-Moscow, 1 night accommodation, meals according to the program, entrance tickets, English speaking guide. Suzdal is a calm old Russian town situated 220 km north-east of Moscow, 38 kilometers north from the city Vladimir, on the Kamenka river. ... Tour program: . ... Excursion to State Tretyakov Gallery . ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

• Invited speakers

General Information . ... The conference is organized by the Sternberg Astronomical Institute (SAI) of Moscow University and the IAU Working group "Site-testing Instruments" . ... Use of site data in telescope operation and adaptive optics. ... Recent conferences on this subject (2007, 2008) demonstrated great interest of the community, hence the need for a new meeting. ... Unlike previous recent conferences, this meeting will cover all aspects of site monitoring for optical/IR astronomy. ...

Еще в разделе: (Показать все результаты (>17) - site2010.sai.msu.ru/ )

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>4) - lcc.chem.msu.ru/ )

... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>5) - td.chem.msu.ru/ )

ISSN 1560-3547, Regular and Chaotic Dynamics, 2015, Vol. ... The Dynamics and Control of a Spherical Robot with an Internal Omniwheel Platform Yury L. Karavaev1* and Alexander A. Kilin 1 2** M. T. Kalashnikov Izhevsk State Technical University, ul. ... The problem of control of spherical robot motion along an arbitrary tra jectory is solved within the framework of a kinematic mo del and a dynamic mo del. ... To describe the motion of a spherical robot, we consider three coordinate systems. ... Vol. ...

Еще в разделе: (Показать все результаты (>106) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/0cd/RCD232.pdf
• http://ics.org.ru/upload/iblock/d07/157-isomorphisms-of-geodesic-flows-on-quadrics_en.pdf
• http://ics.org.ru/upload/iblock/b7b/RCD190101.pdf

... 2 · ­ , , · ­ · ­ , 03.12.2015 . ... 14 03.12.2015 · · · 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf
• http://lvk.cs.msu.su/~dimawolf/ArchEVM/Lection12.pdf
• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

Кафедра общей топологии и геометрии . ... It is proved that a Tychonoff pseudocompact group with continuous multiplication is a topological group. It is also proved that a Tychonoff countably compact group with separately continuous multiplication is a topological group. A continuous function defined on a product X ? Y of pseudocompact spaces is extended to a separately continuous function defined on the product ?( ...

Еще в разделе: (Показать все результаты (>2) - gtopology.math.msu.su/ )

. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China

Еще в разделе: (Показать все результаты (>9) - www.biophys.msu.ru/ )

Draft Dr. Paul Twomey President and Chief Executive Officer Internet Corporation for Assigned Names and Numbers (ICANN) Speech to Third International Forum Partnership Among State, Business Community and Civil Society in Ensuring Information Security Garmisch-Partenkirchen, Germany Monday, 20 April 2009 Dear Vladislav Petrovich, Dear Alexei Anatolievich, Distinguished guests, Ladies and Gentlemen. ... ICANN itself is evolving, mirroring the changing nature of the global Internet community. ...

Еще в разделе: (Показать все результаты (>12) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/global_dns.pdf
• http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

... The model was then employed to assess the dependence of the association rate constant on the dimensions of the lumen. ... This small (10.5 kDa) protein diffuses in the lumen, a relatively narrow closed space between the thylakoid membranes, oxidizing cytochrome f (Cyt f ) in the membrane complex and then reducing the PS I reaction center. ... However, these works did not consider the diffusion of Pc molecules in the thylakoid lumen or their interaction with the b6 f and PS I membrane-bound complexes...

Еще в разделе: (Показать все результаты (>23) - www.library.biophys.msu.ru/ )

• MECHANISMS OF THE ACTION OF A LOW-FREQUENCY MAGNETIC FIELD ON THE INITIAL

... The notion of convergence to zero in a vector space allows one to define convergence to any p oint by using a translation. ... The notion of a converging sequence can b e introduced without any top ology, by the definition of all sequences converging to some p oint. ... 1, then the sequence n xn converges to zero. ... In the case of the Euclidean top ology, where for at least one comp onent the inequality ci > 1/4 holds, the set J (f ) coincides with the whole space and hence the Julia set is empty....

Еще в разделе: (Показать все результаты (>38) - shamolin2.imec.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

... M.V.Lomonosov Moscow State University . ... Physicists from Lomonosov Moscow State University studied the dynamics of multiple cavitation bubbles excited by a fs laser superfilament and developed a new approach for their control by laser pulse energy and external focusing. For the first time an innovative method of controlling the dynamics of cavitation bubbles excited by the distributed laser-plasma source (filament) was demonstrated. ... 119991, Moscow, . ...

Еще в разделе: (Показать все результаты (>68) - phys.msu.ru/ )

... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>11) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University

... MATHEMATICAL AND SYSTEM BIOLOGY UDC 577.1 Membrane Profile-Based Probabilistic Method for Predicting Transmembrane Segments via Multiple Protein Sequence Alignment R. A. Sutormina and A. A. Mironova a b , b, c State Research Center GosNIIgenetika, Moscow, 117545 Russia; e-mail: sutor_ra@mail ... Bioinformatics, Moscow State University, Moscow, 119992 Russia Received January 25, 2006 Abstract--Prediction of transmembrane (TM) segments of amino ... Protein Sci. ... Proteins. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>46) - cdfe.sinp.msu.ru/ )

• CDFE => Online services => Chart of Nuclear Quadrupole Deformations Recommended
• EXFOR Search Engine

... Changed pages: posts/seminar-24.03.2016 . Changed by: alexeybrazhe . Commit type: git . ... Changed pages: posts/seminar-03.12.2015 . ... Changed pages: posts/seminar-25.12.2014 . ... Changed pages: posts/seminar-03.03.2015 posts/seminar-10.03.2015 . ... Changed pages: local.css posts/seminar-03.03.2015 . ... Changed pages: local.css posts/seminar-24.09.2013 . ... Changed pages: local.css media/files/seminar-24.09.2013.2.png media/files/Киселева автореферат.doc posts/seminar-24.09.2013 . ...

Еще в разделе: (Показать все результаты (>29) - cell.biophys.msu.ru/ )

• comments

... The Informativeness of Coherence Analysis in EEG Studies A. P. Kulaichev UDC 612.821.6 Translated from Zhurnal Vysshei Nervnoi Deyatel'nosti imeni I. P. Pavlova, Vol. ... KEY WORDS: coherence, spectral analysis, EEG non-stationarity, amplitude modulation. ... In particular, the two fundamental differences between EEG signals and most other physical signals are not considered: a) fundamental non-stationarity; b) amplitude modulation at all frequency ranges. ... Coherence in technical addenda. ...

Еще в разделе: (Показать все результаты (>13) - www.protein.bio.msu.ru/ )

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>12) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2012/abstracts/Kurbatsky.doc