SPAW Editor PHP Edition version 1.0.6 Release Notes Thanks to everyone who downloaded, tried and supported SPAW Editor! This release includes several new features: css classes for tables, background images in tables and table cells, improved link dialog and more. ... If you are fluent in any of languages that are now included and see any typos or mistakes please report to spaw@solmetra.com Happy editing, Alan Mendelevich a.k.a. ailon alan@solmetra.com ...

Еще в разделе: (Показать все результаты (>3) - textbook.sinp.msu.ru/ )

• SPAW Editor documentation

... Main features of PPC: positive, motivational therapeutic Gospel - departure from negative language towards human; loving, giving God-friend and helper; felt needs placed in the center of ministry; accent on positive human nature; theology becomes a mission of local congregation; Christian doctrine replaced with psychology, sociology, marketing; emergence of new, diverse organizational forms, modified religious practice and contemporary worship. ...

Еще в разделе: (Показать все результаты (>53) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/1/11.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/2/04.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/3/03.pdf

Are this birds live in Russia? Sigg Tobias /nb /00 21 февраля 2002 18:42:26 . ... Im just wonder if you know what this birds are called in Russia?? I m making a bird list and translate them to 12 language but i cant find . this birds in russia.. ... Alectoris rufa . ... Acrocephalus melanopogon . ... Sylvia conspicillata . Sylvia melanocephala . ... Thank you verry much if you can help me and I wish good luck in the . olympic games for russia in Ichockey Thank you .. Tobias . ...

Еще в разделе: (Показать все результаты (>11) - www.ecocoop.ru/ )

... distant.msu.ru . ... Видеоархив МГУ . Список курсов . ... Курсы . Курсы факультетов МГУ . Факультет иностранных языков и регионоведения . ... Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1272 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1516 Курсы для школьников / Курсы от школ-партнеров / ГБОУ СОШ ?1159 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Школа ?2065 Курсы для школьников / Курсы от ...

Еще в разделе: (Показать все результаты (>3) - distant.msu.ru/ )

Aero elastic Wing Flutter LCO as a Hopf Bifurcation Point for a Nonlinear Convolution/Evolution Equation in a Hilb ert Space A. V. Balakrishnan UCLA Department of Electrical Engineering, Los Angeles CA 90095-1594, U.S.A. e-mail: bal@ee.ucla.edu Flutter is an endemic instability of all aircraft that occurs at highenough speed at any altitude. We show how it can be modelled as a Hopf bifurcation point for a nonlinear convolution/evolution equation in a Hilbert space.

Еще в разделе: (Показать все результаты (>24) - pont2008.cmc.msu.ru/ )

... Gas evolution from Brazilian rock crystal and quartz as raw materials for producing silica glass . ... Gas content, along with the content of element impurities and the content of mineral inclusions, is one of the most important characteristics of quality for quartz raw materials in producing high-quality silica glass. Gas evolution from rock crystal and vein quartz from Brazil as quartz raw materials for producing high-quality silica glass has been studied. ...

Еще в разделе: (Показать все результаты (>32) - www.kge.msu.ru/ )

• IVAKIN YURY DMITRIEVICH
• Научная информация

... 2013/04/16 - 11:59am . ... After the education at High School of Management and Innovation graduates receive the state approved diploma of Lomonosov Moscow State University for a specialized educational programme "Strategic Management and Innovation" and become "Masters of Management". ... Admission procedure in 2013 in direction of "Management" for the programme "Strategic Management and Innovation" provides for contracts with 50 persons . ... 2006-2016 MSU Higher School of Management and...

Еще в разделе: (Показать все результаты (>10) - hsmi.msu.ru/ )

• User account | MSU Higher school of management and innovation
• Project and Process Management | MSU Higher school of management and innovation
• We are assembling training courses! | MSU Higher school of management and

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>8) - angel.cmc.msu.ru/ )

• http://angel.cmc.msu.ru/~ifed/teraflops/Popova_MPI.pdf

... Electronic journal Issue 4. 10 september 2004 Paliulis N., Chlivickas E. E-government as a Challenge of Public Management Development Introduction. ... This also includes the transfer of various data from hardcopies (documents) to digital media (databases), provision of information and services to citizens and businesses via electronic means (websites, e-mails, etc.) ... The main obstacle for the development of electronic public services is the small number of Internet users in Lithuania. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

Evolutionary Ecology 1998, 12, 291±307 Evolutionarily optimal age schedule of repair : Computer modelling of energy partition between current and future survival and reproduction ANATOLY T. TERIOKHIN Department of Biology, Moscow State University, Moscow 119899, Russia Summary The aim of this study was to ... Let us now look at the inЇuence of the level of external mortality, associated with the parameter , on the optimal energy partition between reproduction and current survival. ...

Еще в разделе: (Показать все результаты (>44) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2003_Envir_human_EER.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2001_DissConclusion.doc

... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...

Еще в разделе: (Показать все результаты (>17) - www.protein.bio.msu.ru/ )

The most up-to-date information related to atmos 3.0 are collected here due to constantly increasing interest to MASS/DIMM processing software... atmos 3.0 is still beta , so the latest version is 2.97.5 (there is also 2.98.x branch which absorbs new features) . ... M' line: . ... free seeing and its relative error . ... dimm seeing and its relative error (if dimm data are present, zeros otherwise) . ... dimm turbulence power and its relative error (if dimm data are present, zeros otherwise) . ...

Еще в разделе: (Показать все результаты (>25) - curl.sai.msu.ru/ )

• . The . MASS . Group .

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

... AGP , Cg , CAL , CrossFire , CTM , CUDA , DirectX , DPVM , GLSL , HLSL , OpenGL , PCI Express , RapidMind , SLI , ВидеоОЗУ , Графическая карта , ГПУ , ОВГПУ , Потоковый процессор , Проход , Шейдер , Шейдерное функциональнее устройство , Шейдерный конвейер . ... Cg (C for Graphics) - C-подобный язык программирования шейдеров, разработанный компанией NVidia. В настоящее время поддерживается под DirectX и OpenGL как для графических карт NVidia, так и AMD. ... Проход - один этап вычисления на ГПУ. ...

Еще в разделе: (Показать все результаты (>4) - gpu.parallel.ru/ )

• Новости

The M.V. Lomonosov Moscow State University is organizing a traditional International Conference "BIOCATALYSIS-2007" in 17-22 June 2007 (preliminary dates were changed). ... Structure, catalytic mechanism and protein engineering of enzymes. ... EURO . ... In view of a limited number of ship cabin passengers, the Organizing Committee is asking to apply for participation at BIOCATALYSIS-2007 Conference, to send the Abstracts and to pay the Registration Fee not later than the deadlines indicated above. ...

Еще в разделе: (Показать все результаты (>128) - www.enzyme.chem.msu.ru/ )

• index
• Group of microbial biochemistry and biotechnology

Theoretical problems of electrical double layer structure on ideally polarized electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistage electrochemical processes limited by mass transfer, electron transfer and chemical reaction. ... Acta, 1997, V.42, P.737. ... 1997, V.33, N 10. ... 1997, V.33, N 11. head@elch.chem.msu.ru . ...

Еще в разделе: (Показать все результаты (>18) - www.elch.chem.msu.ru/ )

• Molecular aspects of solid state and interfacial electrochemistry
• Laboratory of Electrocatalysis and corrosion

... Архитектура пакета . ... Пакет содержит типы данных и алгоритмы для поддержки теории формальных языков в системе Maple. ... Для представления символов используется тип type/character , Для представления цепочек тип type/string . ... Основной новый тип: Language . ... Каталог с исходными текстами пакета имеет следующую структуру. src\ . ... Конструкторы и утилиты к типу Language . ... Конструкторы и утилиты к типу Acceptor . ... конструкторы объектов имеют префикс new , например: newLanguage() . ...

Еще в разделе: (Показать все результаты (>3) - al.cs.msu.ru/ )

... Synchronous Evolution of Galaxies in Groups: NGC 524 Group O. K. Sil'chenko and V. L. Afanasiev 245 ISSN 1990-3413, Astrophysical Bulletin, 2012, Vol. ... Four of the five galaxies revealed synchronized bursts of star formation in the nuclei 1­2 Gyr ago. The only galaxy, in which the ages of stellar population in the nucleus and in the bulge coincide (i.e. the nuclear burst of star formation did not take place) is NGC 502, the farthest from the center of the group of all the galaxies studied. ...

Еще в разделе: (Показать все результаты (>48) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/mydata/curvit.html

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>7) - compmech.math.msu.su/ )

script language= javascript on=mw=null; fl=ofl=0; mc=me=0; t=0; b=0; ch=bt=bn=0; wn=wt=null; sl=0; t2=0; function Is0CC28989() { this.n=(document.layers)?true:false; this.o=(navigator.userAgent.indexOf('Opera')!=-1)?true:false; this.i=(document.all (!this.o))?true:false; this.d=(document.getElementById)?true:false; } var is0CC28989=new Is0CC28989(); function Stor() { if(is0CC28989.n (top.frames.length 0)){ return top.frames[0]; } ...

Еще в разделе: (Показать все результаты (>80) - www.kosmofizika.ru/ )

• Frequently Seen Space/Astronomy Acronyms