organic papers Acta Crystallographica Section E Structure Reports Online ISSN 1600-5368 4,6-Dimethyl-5-nitro-1H-pyridin-2-one Victor B. Rybakov,* Alexander A. Bush, Eugene V. Babaev and Leonid A. Aslanov Department of Chemistry, Moscow State University, 119992 Moscow, Russian Federation Correspondence e-mail: rybakov@biocryst.phys.msu.su In the crystal structure of the title compound, C7H8N2O3, molecules form centrosymmetrical dimers via N HСССO hydrogen bonds. ... 2004). ... Acta Cryst. ... Cryst. ...

Еще в разделе: (Показать все результаты (>132) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/121e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/123e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/120e.pdf

... The colleges had gathered a lot of experience in upbringing of young people. ... Keywords: historical anthropology, cultural history, daily city life, women's education, modernisation, school medicine, empress Maria's establishments, closed girls' colleges Strokina A.N., Butareva I.I. Ergonomics measurements of body schoolchildren (p. 30) The article presents the children's body size, intended for the construction of facilities and activities for communities associated with their use of spaces. ...

Еще в разделе: (Показать все результаты (>23) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_2.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>87) - npidb.belozersky.msu.ru/ )

... Research . Research Areas . ... Home News Colloquium on 18.05.09 . ... New publications of laboratory employees: . ... Colloquium on 26.02.09 . ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Colloquium on 19.10.12 15 Oct 2012 . Lomonosov Moscow State University . Department of Chemistry . ... Division of Physical Chemistry . Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>37) - td.chem.msu.ru/ )

• Colloquium on 07.12.12 Laboratory of Chemical Thermodynamics
• Colloquium on 09.11.12 Laboratory of Chemical Thermodynamics
• Colloquium on 14.12.12 Laboratory of Chemical Thermodynamics

Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, Department of the English Language Abstract Categorical Models of Quantum Mechanics By Alexander Zapryagaev, group 304 21 October 2014 The report deals with the axiomatic approach to the phenomena of quantum computation and algorithms. ... Finally, the logic behind quantum operations is discussed: it is revealed that the ideas of quantum algorithms have a strong connection to Jean-Yves Girard's linear logic. ...

Еще в разделе: (Показать все результаты (>14) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Notice_2013.pdf
• http://www.eng.math.msu.su/download/Podkolzina_TA_Test_Your_Knowledge_of_Great_Britain.pdf

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>1224) - swx.sinp.msu.ru/ )

... Новости Астрономии и Космонавтики: от ПРАО , от "Звездочета" , от Железнякова , от "Переплета" ; . ... Рейтинг страниц в теме: . ... В списке темы всего страниц: 29 , из них 7 новых (менее 100 дней) и 1 малооцененных (менее 5 оценок) . ... Оценено и сдано в архив! . ... Rambler-Наука (в т.ч. Астрономия) . ... Курс общей астрономии' (4-е издание, для высших учебных заведений) new! ... Основы астрономии (учебный курс на базе основ физики и математики) new! ... Проект 'Физика и астрономия' new! ...

Еще в разделе: (Показать все результаты (>9) - www.astrotop.ru/ )

... Soc. 376, 1033­1046 (2007) doi:10.1111/j.1365-2966.2007.11549.x Kinematics and stellar populations of the dwarf elliptical galaxy IC 3653 I. V. Chilingarian,1 1 2 ,2,3 P. Prugniel, 2,4 O. K. Sil'chenko1 and V. L. Afanasiev 5 Sternberg Astronomical Institute of the Moscow State University, Universitetsky pr. ... Fitting the spectra with synthetic single stellar populations (SSP), we found an SSPequivalent age of 5 Gyr and nearly solar metallicity [Fe/H] =-0.06 dex. ... 2007 The Authors. ...

Еще в разделе: (Показать все результаты (>47) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/203546.ps.gz
• http://sn.sai.msu.ru/~sil/preprints/n80eng.pdf
• Recent publications

Information message On November 2-3, 2005 Lomonosov Moscow State University will conduct jointly with the Academy of Cryptography of the Russian Federation the Forth All- Russian scientific Conference Mathematics and Security of Information Technologies and jointly with the Center of International Studies, Cambridge University , United Kingdom, Advanced Research Workshop Unconventional ... Conference Co-Chairmen 1. ... Sherstyuk V.P. - Security Council of the Russian Federation; 3. ...

Еще в разделе: (Показать все результаты (>8) - suny.msu.ru/ )

• http://www.suny.msu.ru/en/CyberCon05En.doc
• http://www.suny.msu.ru/ru/Lavine's%20article.pdf
• Центр по делам России и США :: Публикации

... The model was then employed to assess the dependence of the association rate constant on the dimensions of the lumen. ... This small (10.5 kDa) protein diffuses in the lumen, a relatively narrow closed space between the thylakoid membranes, oxidizing cytochrome f (Cyt f ) in the membrane complex and then reducing the PS I reaction center. ... However, these works did not consider the diffusion of Pc molecules in the thylakoid lumen or their interaction with the b6 f and PS I membrane-bound complexes...

Еще в разделе: (Показать все результаты (>12) - www.library.biophys.msu.ru/ )

... 2006 ARTICLE I. NAME AND PURPOSE Section 1. ... C. Secretary: The Secretary shall be the custodian of the records of the IHSS, maintain an up-to-date list of members in collaboration with the Vice President/President Elect and Chapter Coordinators, maintain minutes of all membership and Board meetings, conduct or supervise the correspondence of the IHSS, serve as editor of the IHSS Newsletter, and shall perform such other duties that may be delegated by the President, Vice President or the Board. ...

Еще в разделе: (Показать все результаты (>98) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2007/perminova-preparation-2007.pdf
• http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf
• http://www.mgumus.chem.msu.ru/publication/2012/2012-karpiouk-self.pdf

... Strike-slip magmatic duplexes . ... During 1996-1998 we have carried out a complex field and laboratory study of particular class of the geological objects, which we named strike-slip magmatic duplexes (SSMD), in limits of the Eastern Urals, Central Kazakhstan and Kola-Karelia region. ... 2) We recovered within the Eastern Urals a series of geological objects identidied as SSMD of different age and of different deepness, and studied them in detail due to field investigations. ...

Еще в разделе: (Показать все результаты (>13) - sbmg.geol.msu.ru/ )

• Абсарокит

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>6) - lcc.chem.msu.ru/ )

... 2007 Г., ?1, ВЫП.5 . 2006 Г., ?3, ВЫП. ... 2006 г., ?1, вып. ... Начал работу новый сайт электронного научного журнала ?ДОКЛАДЫ ПО ЭКОЛОГИЧЕСКОМУ ПОЧВОВЕДЕНИЮ? ... Института экологического почвоведения МГУ им. М.В.Ломоносова. Итоги Международной научной конференции ?Роль почв в биосфере и жизни человека? ... Новый сайт . ... Институт экологического почвоведения МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>3) - jess.msu.ru/ )

• adms | Доклады по экологическому почвоведению
• Доклады по экологическому почвоведению | Электронный научный журнал

. Home . Commission Members . Meetings . Newsletters . Forum . Electronic magazines . Commission publications . Forum archive . International Union of Soil Science . Commission on Paleopedology . International Union for Quaternary Research . Subcommission on Paleopedology . IUSS . << RERUM COGNOSCERE CAUSAS . Forthcoming meetings . Past meetings reports

Еще в разделе: (Показать все результаты (>3) - www.paleopedology.msu.ru/ )

... General astronomy . ... PHYSICAL CONSTANTS.. ... Nobel Laureates in Physics 1901-2002 . ... Lectures Astronomy-161 "Solar System" (Also it contains info about History of Astronomy) . ... The History of Science . ... College-Level Astronomy Courses - at American, Australian Universities and Colleges . ... Messier: . ... Science . ... Scientific American . ... JOURNAL OF COMPUTATIONAL PHYSICS . ... Scientific Journals . ... American Physical Society Journals: Physical Review, Review of Modern Physics ...

Еще в разделе: (Показать все результаты (>10) - astrometric.sai.msu.ru/ )

• Symbolic circuit processor
• Astronomy

... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>4) - pk.math.msu.ru/ )

• IX Festival of Science | Mechmath admission for internetional students
• About Mathematics and Mechanics Faculty | Mechmath admission for internetional
• information | Mechmath admission for internetional students

Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...

Еще в разделе: (Показать все результаты (>18) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf

... 231 Mathematical Statistics and Problems of Ancient Chronology. ... The methods are applied to the problem of correct dating of the events in ancient chronology. These results induce conjecture on the redating of some historical events. ... We call such texts statistical duplicates. ... Fomenko, A. T.: New Experimental and Statistical Methods for Dating Events of Ancient History and Applications to Global Chronology of Ancient World and Middle Ages, British Library, Dept. of Printed Books, Cup. ...

Еще в разделе: (Показать все результаты (>90) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/gorm/dating/vesuvius.pdf
• http://hbar.phys.msu.ru/articles/ligorep97.pdf
• Appendix: Scaliger's List of Eras