... Class . ... FIELD | ... METHOD . ... public interface NetcdfService . ... This service provides a way to 'open' remote Netcdf data sets by name. ... list () . ... Field Detail public static final java.lang.String SVC_NAME . ... If the name is not the same as one obtainable from the list() opteration on this service, then this method will fail. ... NetcdfRemoteProxy which can be used to create an instance of RemoteNetcdf. public java.lang.String[] list () throws java.rmi.RemoteException . ...

Еще в разделе: (Показать все результаты (>53) - angel.cs.msu.su/ )

• : Interface Accessor
• ExtensionFileFilter
• : Interface MultiArrayInfo

... The circular sidewall of the layer was made of plexiglass. ... This is in contrast to the situation of horizontal layer where longitudinal magnetic field doesn't influence on convective instability and only renders oriented effect [8,10]. [ pic ] Figure 6 Stability boundaries of thermally driven shear flow in an inclined ferrofluid layer in the presence of a longitudinal magnetic field : a - shear flow ; b - convection rolls aligned with the shear flow ; c - convection ...

Еще в разделе: (Показать все результаты (>14) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/CD/BozhkoAAPutinGF.pdf
• http://hit-conf.imec.msu.ru/books/NeZaTeGiUs_2010.pdf

... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...

Еще в разделе: (Показать все результаты (>5) - geophys.srcc.msu.ru/ )

• http://geophys.srcc.msu.ru/library/wind_stress.pdf
• Лаборатория суперкомпьютерного моделирования природно-климатических процессов

. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the

Еще в разделе: (Показать все результаты (>7) - optics.sinp.msu.ru/ )

• Winamp Generated PlayList

HERMITE FUNCTIONS EXPANSION BASED NON-LOCAL MEANS ALGORITHM FOR CT-APPLICATIONS1 N. Mamaev2, A. Lukin3, D. Yurin4, M. Glazkova5, V. Sinitsin6 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia mamaev.nikolay93@mail.ru, 3lukin@ixbt.com, 4yurin@cs.msu.ru 5,6 Federal Center of Medicine and Rehabilitation Ivan'kovskoye sh., ... Noise in CT-images is close to Gaussian [3]. ...

Еще в разделе: (Показать все результаты (>10) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/files/courses/ipintro2012/Lec_Pt1_Color_photo.pdf
• http://imaging.cs.msu.ru/pub/2013.PRIA.Levashov_Yurin.RidgeAndTree.en.pdf
• http://imaging.cs.msu.su/~yurin/Doxyfile

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• ConClus

... Executive MBA programs have kept their popularity among high-ranking businesspeople in Russia, despite the economic crisis. ... The Chicago School of Business created the first EMBA program in 1943, and more than 300 programs now exist worldwide, according to the Executive MBA Council, an international business education association. ... Even when the EMBA program uses the same business cases as the MBA offering, Boltrukevich said, the education s different because the group of students is different...

Еще в разделе: (Показать все результаты (>44) - www.mgubs.ru/ )

• Вестник Московского университета | Высшая школа бизнеса МГУ им. Ломоносова

... The data on UV glow of the atmosphere obtained in operation of one pixel of the TUS detector on board the Moscow State University "Universitetsky-Tatiana" satellite was taken into account in design of the updated TUS detector. ... The main feature of the design is use of MEMS technology scanning mirror controlled by the TUS computer, analyzing the recorded EAS data and directing the laser to the atmosphere spot, where back scattered Cherenkov light came from. ... Monitoring of UV intensity on-route....

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

• http://cosrad.sinp.msu.ru/experiments/tus/doc/Ponce2007fin.pdf

... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 ­ 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf

Introduction to PLASMA ASTROPHYSICS (Selected 10 lectures) Boris V. Somov Astronomical Institute and Faculty of Physics Moscow State University Pushino-na-Oke, 2008 Contents Ab out These Lectures 1 Particles and Fields: Exact Self-Consistent Description 1.1 Liouville's theorem . . . . . . . . . . . . . . . . . . . 1.1.1 Continuity in phase space . . . . . . . . . 1.1.2 The character of particle interactions 1.1.3 The Lorentz force, gravity . . . . . . . . . 1.1.4 Collisional friction . . . . . . . . . . . .

Еще в разделе: (Показать все результаты (>2) - sun.sai.msu.ru/ )

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>4) - depository.msu.ru/ )

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>29) - ideas.msu.ru/ )

• http://www.msu.ru/int/newpr/7ram/7ram_info.pdf
• http://ideas.msu.ru/docs/Evaluation_panels.pdf
• http://www.msu.ru/int/newpr/7ram/7ram_napr.pdf

... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...