... О кафедре . ... Научная работа . ... Главная Научная работа Математические модели взаимодействия элементарных и структурированных объектов . ... Ведущий научный сотрудник Эльтеков В.А. В разное время в состав группы входили: Н.Н.Шапошников, А.В.Овсянкин, В.Б.Шикалов, Н.Г.Васичкина (кафедра математики), Л.П.Развина, О.В.Попова, Н.Н.Негребецкая (кафедра физической электроники), В.Н.Самойлов, Н.Г.Ананьева (кафедра общей физики). ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>11) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Наши

ФЕДОТОВ Михаил Валентинович доцент кандидат физ.-матем.наук: 1989 МГУ контакты: fedotov@cs.msu.su СЕМИНАРЫ: Математический анализ 1-2 семестры, 1курс-2поток Обыкновенные дифференциальные уравнения 3-4 семестры, 2курс-1поток НАУЧНЫЕ ИНТЕРЕСЫ: математическая физика дифференциальные уравнения численные методы математические модели нелинейной оптики ПУБЛИКАЦИИ: |V.Trofimov, M.Fedotov, A.Volkov, N.Tcherniega, V.Savranskii, S.Lan. ... факультет ВМК МГУ, МАКС Пресс, 2010. - 264 стр. | ... 1988. ...

Еще в разделе: (Показать все результаты (>14) - mph.cmc.msu.ru/ )

• http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc

Theoretical problems of electrical double layer structure on ideally polarized electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistage electrochemical processes limited by mass transfer, electron transfer and chemical reaction. ... Acta, 1997, V.42, P.737. ... 1997, V.33, N 10. ... 1997, V.33, N 11. head@elch.chem.msu.ru . ...

Еще в разделе: (Показать все результаты (>10) - www.elch.chem.msu.ru/ )

• Molecular aspects of solid state and interfacial electrochemistry

... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the protein­protein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...

Еще в разделе: (Показать все результаты (>20) - www.library.biophys.msu.ru/ )

• http://www.library.biophys.msu.ru/PDF/80551.pdf
• http://www.library.biophys.msu.ru/PDF/80522.pdf
• MonKar4

Using Site testing data for Adaptive Optics simulations Kislovodsk, October 2010 1Glen Herriot, 1David Andersen, 1Jean-Pierre VИran, 2Brent Ellerbroek, 2Luc Gilles, 2Lianqi Wang 1National Research Council Canada ­ Herzberg Institute of Astrophysics 2TMT Project Office, Pasadena TMT.AOS.PRE.10.074.REL01 1 Outline TMT / NFIRAOS Site Testing Parameters and their value for Adaptive Optics Simulations ... TMT.AOS.PRE.10.074.REL01 9 What is the interest of Adaptive Optics in r 0 Seeing ? ...

Еще в разделе: (Показать все результаты (>21) - site2010.sai.msu.ru/ )

• http://site2010.sai.msu.ru/static/doc/AOtarola_site2010.pdf

... Научный календарь МГУ Научная жизнь на ФГУ Конференции Научные семинары Международная конференция ФГУ International Conference Молодым ученым Электронные ресурсы Список полнотекстовых баз данных (журналы) Список полнотекстовых баз данных (книги) Список реферативных баз данных Материалы международных конференций Архив мероприятий Конференции Научные семинары Круглые столы Презентации Международная конференция ФГУ Фестиваль науки Международное сотрудничество . ... Agricultural and Biological Sciences ...

Еще в разделе: (Показать все результаты (>16) - www.spa.msu.ru/ )

. Our Atlas server news 1 (Feb 06, 2008) [Rus, utf-8] .

Еще в разделе: (Показать все результаты (>17) - lhe.sinp.msu.ru/ )

... On-line консультант . ... Место работы, должность: Преподаватель, старший научный сотрудник Лаборатории Вычислительных комплексов ВМК МГУ имени М.В.Ломоносова . ... D. Gamayunov, R. Smeliansky. ... 2002. (in Russian) . D. Gamayunov, A. Kachalin. ... In proceedings of the fifth Russian Applied and . ... detectors of computer attacks for corporate networks. ... I. Bulgakov, D. Gamayunov, E. Toroschin, Detecting network worms . ... Опыт работы по тематике магистратуры: 9 лет (руководство . ...

Еще в разделе: (Показать все результаты (>14) - erp.cmc.msu.ru/ )

... DESERTIFICATION AND SOIL DEGRADATION . MOSCOW, RUSSIAN FEDERATION . ... Prof., Dr. Kust G.S., Prof., Dr. Zonn I.S., Russia, Moscow . ... Degradation and Desertification of Soils and its Preventing in Adaptive-Landscape Agriculture" . ... Andreeva O.V., Russia, Moscow . Mapping and Assessment of Desertification/Soil Cover Degradation of Russian Federation" . ... Soil Degradation and Problem of Their Desertification in the Kustanay Region of Kazakhstan" . ... Breakfasts are included . ...

Еще в разделе: (Показать все результаты (>512) - www.fadr.msu.ru/ )

• D.N.Durmanov OPENING WORD
• EcoPhoto - Архив - Небесные явления Supernal phenomenons
• CCI Ag Initiative Russian Publications

... Main practical applications of X-rays lie in the important for the society fields of medical imaging, custom, transport inspection and security. Scientific applications besides of fundamental research include material sciences, biomicroscopy, and protein crystallography. ... The first are relatively cheap, robust, and compact but have low brightness and poorly controlled photon spectrum. ... So accelerator based X- ray sources are mainly still used for scientific applications and X-ray tubes ? ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Laser-Electron X-Ray Source for Medical Applications | Проект ЭЛЛАРИ

... download [ 61679 ] . Effects of the Seafloor Topography on Tsunami Generation Explored for the Messina 1908 tsunami through 2-D finite element modeling . ... What Evidence Exists for Paleotsunami Triggered by Local Earthquakes in the Wellington Region of New Zealand? ... Didenkulova I. I. and Pelinovsky E. N. (Russia) . ... Near-Shore Oceanic Earthquakes: Application of Acoustic Methods to Detect Earthquake Precursory Phenomena and Possible Improvements of Tsunami Warning Systems . ...

Еще в разделе: (Показать все результаты (>21) - seac47-2.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

... In vitro, the protein S7 of Thermus thermophilus is able to form complexes with both the minimal 16S rRNA fragment and the intercistronic region of the str operon mRNA from E.coli (Kd = 1.4x10-7 M and 1.1x10-7 M respectively). ... The filter binding assay. ... The most striking result of our study is that thermophilic protein S7 binds strongly to the E.coli S12-S7 intercistronic region of str mRNA in vitro, inspite of the lack of the functionally analogous thermophilic extended region. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf
• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf

... 2002. ... 110 MT2 MT8, 9 MT8 MT2 MT8 111 373 374 MT8 MT2 375 376 MT8 MT8 MT8 MT7 377 3 MT2 378 379 MT8 MT1 MT8 MT7 380 MT5 MT2 381 382 MT2, 5, 6, 7 MT2 383 . ... MT1, 8 112 MT7 MT8 MT4 MT8 MT2 MT7 MT8 MT2, 5, 6, 7 MT2 MT1 8 MT2 MT8 MT2, 8 MT8 MT8 113 MT8 MT8 MT7, 8 MT8 MT4 MT8 MT2 MT1, 2, 4, 7, 8, 9 MT8 MT1-9 395 Gunter C. Semantics of Programming Languages. ... 116 MT9 MT8 117 « » MT8 MT3 MT5, 9 MT8 MT2 MT7 P1, IT8 P1 P1, IT8 IT1, IT8 P1 MT2, 8 P7, IT1 P3, IT1 445 Tucker A. Applied Combinatorics. ...

Еще в разделе: (Показать все результаты (>4) - math.chem.msu.ru/ )

• BK_Assignments - Новый элемент
• BK_Assignments -

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>41) - acoustics.phys.msu.ru/ )

... Department of Mathematics, . Faculty of Physics, MSU . ... Differential equations . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . Numerical methods in physics . ... Abstract differential equations with applications in mathematical physics . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Methods of finite differences in mathematical physics . ... April 13, 2016. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>8) - math.phys.msu.ru/ )

hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>3) - hpc.cs.msu.ru/ )

... Biological Faculty . Moscow State Lomonosov University . ... EDUCATION : B.S. Lomonosov Moscow State University, 1971 Physics . M.S. Lomonosov Moscow State University, 1972 Biophysics . Ph.D. Lomonosov Moscow State University, 1978 Biophysics . ... Lomonosov Moscow State University, 1990 Biophysics . ... 1972-1978 Research assistant Lomonosov State University, Moscow . ... Mathematical modelling in biology, . ... Lecturer at Biological Faculty, Lomonosov State University, Moscow . ...

Еще в разделе: (Показать все результаты (>3) - biophys.msu.ru/ )

... DESCRIPTION General Catalog of Variable Stars (GCVS database) . ... Kholopov P.N., Samus N.N., Durlevich O.V., Kazarovets E.V., Kireeva N.N., Tsvetkova T.M., 1990, General Catalogue of Variable Stars, 4rd ed., vol.IV, Nauka, Moscow. Kholopov P.N., Samus N.N., Durlevich O.V., Kazarovets E.V., Kireeva N.N., Tsvetkova T.M., 1992, General Catalogue of Variable Stars, 4rd ed., vol.IV, Bull. ... Kazarovets E.V., Durlevich O.V. Editor-in-Chief Samus N.N., 1998, New Catalogue of Suspected Variable Stars. ...

Еще в разделе: (Показать все результаты (>58) - sai.msu.ru/ )

• Конференции сайта АстрО

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...